Transcript: Human NM_001286721.2

Homo sapiens ankyrin repeat domain 10 (ANKRD10), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
ANKRD10 (55608)
Length:
1250
CDS:
136..798

Additional Resources:

NCBI RefSeq record:
NM_001286721.2
NBCI Gene record:
ANKRD10 (55608)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001286721.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437658 ACCGGATTGTGAGGGTGAAAC pLKO_005 495 CDS 100% 10.800 8.640 N ANKRD10 n/a
2 TRCN0000429731 CATATTAGTGTGGGAACAAAT pLKO_005 842 3UTR 100% 13.200 9.240 N ANKRD10 n/a
3 TRCN0000426369 AGAATGCATCAGTGCCCTTGT pLKO_005 549 CDS 100% 4.050 2.835 N ANKRD10 n/a
4 TRCN0000150050 CAGAATTGTCATCTGAACCAT pLKO.1 770 CDS 100% 3.000 2.100 N ANKRD10 n/a
5 TRCN0000085280 CGGCAAGTTGGAGTGCTTAAT pLKO.1 339 CDS 100% 13.200 10.560 N Ankrd10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286721.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12232 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_12232 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471743 GTACTTGCGGGATATGTGTTGCAG pLX_317 68.6% 100% 100% V5 n/a
Download CSV