Transcript: Human NM_001351535.2

Homo sapiens IDNK gluconokinase (IDNK), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
IDNK (414328)
Length:
1008
CDS:
240..665

Additional Resources:

NCBI RefSeq record:
NM_001351535.2
NBCI Gene record:
IDNK (414328)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001351535.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000121723 CCAAACAGAACTAAGCATAAA pLKO.1 687 3UTR 100% 13.200 9.240 N IDNK n/a
2 TRCN0000143276 GATTCCATGGCTCTGTAACTT pLKO.1 275 CDS 100% 5.625 3.938 N IDNK n/a
3 TRCN0000145322 GAATTATTGCAGTCCCAGTTT pLKO.1 537 CDS 100% 4.950 3.465 N IDNK n/a
4 TRCN0000145215 GACAGACTTGTTTAGGTGTAA pLKO.1 793 3UTR 100% 4.950 3.465 N IDNK n/a
5 TRCN0000121608 GCTCTGTAACTTGCATGACAT pLKO.1 284 CDS 100% 4.950 3.465 N IDNK n/a
6 TRCN0000145460 GTCCAAACAGAACTAAGCATA pLKO.1 685 3UTR 100% 4.950 3.465 N IDNK n/a
7 TRCN0000139700 CCATGGCTCTGTAACTTGCAT pLKO.1 279 CDS 100% 3.000 2.100 N IDNK n/a
8 TRCN0000122220 GAGACATATTAACACAAGGAA pLKO.1 373 CDS 100% 3.000 2.100 N IDNK n/a
9 TRCN0000140068 GATGGTGTAGCTCTGAAGTGT pLKO.1 396 CDS 100% 3.000 2.100 N IDNK n/a
10 TRCN0000145077 GCTACAATTATGGAAACCCTA pLKO.1 633 CDS 100% 2.640 1.848 N IDNK n/a
11 TRCN0000143398 CTGAATTATTGCAGTCCCAGT pLKO.1 535 CDS 100% 2.160 1.296 N IDNK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001351535.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13682 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_13682 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000480049 CATGTGCCAAAGCACATCCCAGTC pLX_317 98.6% 100% 100% V5 n/a
4 TRCN0000488718 CCCTAAGTTCTTCTAGCTCCTGGC pLX_317 54% 75.4% 75.4% V5 (not translated due to prior stop codon) 0_1ins138 n/a
Download CSV