Transcript: Human NM_001097641.2

Homo sapiens fucosyltransferase 3 (Lewis blood group) (FUT3), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-06-04
Taxon:
Homo sapiens (human)
Gene:
FUT3 (2525)
Length:
2024
CDS:
73..1158

Additional Resources:

NCBI RefSeq record:
NM_001097641.2
NBCI Gene record:
FUT3 (2525)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001097641.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035865 CGCACTGCTATTTCAGCTGCT pLKO.1 126 CDS 100% 2.160 1.512 N FUT3 n/a
2 TRCN0000414991 CACGGTTTCCAGATGTAATAC pLKO_005 1620 3UTR 100% 13.200 7.920 N FUT3 n/a
3 TRCN0000035867 GCCCTGGACAGATACTTCAAT pLKO.1 514 CDS 100% 5.625 3.375 N FUT3 n/a
4 TRCN0000035864 GCGCTGGATCTGGTTCAACTT pLKO.1 462 CDS 100% 4.950 2.970 N FUT3 n/a
5 TRCN0000035866 ACATGGCCTTTCCACATCCCT pLKO.1 277 CDS 100% 0.750 0.450 N FUT3 n/a
6 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 1899 3UTR 100% 4.950 2.475 Y ERAP2 n/a
7 TRCN0000035927 CAGAAGCAACTACGAGAGGTT pLKO.1 903 CDS 100% 2.640 1.320 Y FUT5 n/a
8 TRCN0000035868 GCCCGCTACCTGAGCTACTTT pLKO.1 1012 CDS 100% 1.875 0.938 Y FUT3 n/a
9 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1900 3UTR 100% 13.200 6.600 Y LIAS n/a
10 TRCN0000443336 GAGACCTTGCCACACTGAATG pLKO_005 1456 3UTR 100% 10.800 5.400 Y FUT5 n/a
11 TRCN0000035890 GCTGTGTGTTTCTTCTCCTAT pLKO.1 151 CDS 100% 4.950 2.475 Y FUT6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001097641.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00598 pDONR223 100% 99.8% 99.4% None 202C>T;314T>C n/a
2 ccsbBroad304_00598 pLX_304 0% 99.8% 99.4% V5 202C>T;314T>C n/a
3 TRCN0000476252 CAACCCTACGTTACGTTATCCTGA pLX_317 29.6% 99.8% 99.4% V5 202C>T;314T>C n/a
Download CSV