Transcript: Human XM_024449917.1

PREDICTED: Homo sapiens lipase C, hepatic type (LIPC), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LIPC (3990)
Length:
1682
CDS:
136..1635

Additional Resources:

NCBI RefSeq record:
XM_024449917.1
NBCI Gene record:
LIPC (3990)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024449917.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000050711 CCATGTCACTACTCGGAACAA pLKO.1 1253 CDS 100% 4.950 6.930 N LIPC n/a
2 TRCN0000050708 CGAAGCCATGTTCACCTAATT pLKO.1 610 CDS 100% 13.200 10.560 N LIPC n/a
3 TRCN0000050712 GCCCTTGGACAAAGCCTGAAA pLKO.1 199 CDS 100% 4.950 3.465 N LIPC n/a
4 TRCN0000050710 GCATGAGATGAAGACCAGATT pLKO.1 270 CDS 100% 4.950 2.970 N LIPC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024449917.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06526 pDONR223 100% 99.7% 99.7% None (many diffs) n/a
2 ccsbBroad304_06526 pLX_304 0% 99.7% 99.7% V5 (many diffs) n/a
3 TRCN0000487889 CTAAGAAACCTTGGATAAATAGCC pLX_317 19.3% 99.7% 99.7% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000491567 TACAACGACCACTGGCGCCTAGAC pLX_317 19.1% 99.6% 99.6% V5 (many diffs) n/a
Download CSV