Transcript: Human NR_156701.2

Homo sapiens scinderin (SCIN), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-07-16
Taxon:
Homo sapiens (human)
Gene:
SCIN (85477)
Length:
9504
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_156701.2
NBCI Gene record:
SCIN (85477)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_156701.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116623 CCGCTCATTATTTACAAGAAT pLKO.1 1535 3UTR 100% 5.625 4.500 N SCIN n/a
2 TRCN0000116625 TGGAAAGGTAAAGATGCTAAT pLKO.1 953 3UTR 100% 10.800 7.560 N SCIN n/a
3 TRCN0000116622 GCCTTGGAAGTTATTCTCTTT pLKO.1 2721 3UTR 100% 4.950 3.465 N SCIN n/a
4 TRCN0000116626 GCTGAAGAATTTCTACAGCAA pLKO.1 1004 3UTR 100% 2.640 1.848 N SCIN n/a
5 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 2163 3UTR 100% 4.950 2.475 Y CFLAR n/a
6 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 2163 3UTR 100% 4.950 2.475 Y C19orf31 n/a
7 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 5983 3UTR 100% 4.950 2.475 Y ERAP2 n/a
8 TRCN0000162795 CTTCCAAAGTGCTGGGATTAT pLKO.1 8533 3UTR 100% 13.200 6.600 Y SLC48A1 n/a
9 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 5984 3UTR 100% 13.200 6.600 Y LIAS n/a
10 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 2161 3UTR 100% 4.950 2.475 Y ERN2 n/a
11 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 2161 3UTR 100% 4.950 2.475 Y P3H4 n/a
12 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 2161 3UTR 100% 4.950 2.475 Y P3H4 n/a
13 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 6149 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_156701.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12783 pDONR223 100% 2% None (many diffs) n/a
2 ccsbBroad304_12783 pLX_304 0% 2% V5 (many diffs) n/a
3 TRCN0000478282 TATCTGCTCCACCGGGCTCCGTTG pLX_317 100% 2% V5 (many diffs) n/a
Download CSV