Transcript: Human NM_001370230.1

Homo sapiens kazrin, periplakin interacting protein (KAZN), transcript variant G, mRNA.

Source:
NCBI, updated 2019-07-10
Taxon:
Homo sapiens (human)
Gene:
KAZN (23254)
Length:
3737
CDS:
314..1228

Additional Resources:

NCBI RefSeq record:
NM_001370230.1
NBCI Gene record:
KAZN (23254)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001370230.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000164593 CCCTATTGTACAGTCACTAGA pLKO.1 1199 CDS 100% 4.950 6.930 N KAZN n/a
2 TRCN0000163756 GTACAGTCACTAGAGGATCTT pLKO.1 1206 CDS 100% 4.950 3.960 N KAZN n/a
3 TRCN0000164683 CGAGACTTCATCCGCAACTAT pLKO.1 638 CDS 100% 5.625 3.938 N KAZN n/a
4 TRCN0000165510 GAAGAACCTGCACAACCCTAT pLKO.1 1184 CDS 100% 4.050 2.835 N KAZN n/a
5 TRCN0000164495 CAACCCTATTGTACAGTCACT pLKO.1 1196 CDS 100% 2.640 1.848 N KAZN n/a
6 TRCN0000166808 CAGTTCAGAAGAACCTGCACA pLKO.1 1177 CDS 100% 2.640 1.848 N KAZN n/a
7 TRCN0000165571 GTCAACAGACTCTCTACCACT pLKO.1 984 CDS 100% 2.640 1.848 N KAZN n/a
8 TRCN0000164924 GCAGAGTCAACAGACTCTCTA pLKO.1 979 CDS 100% 0.495 0.347 N KAZN n/a
9 TRCN0000165645 GAGTCAACAGACTCTCTACCA pLKO.1 982 CDS 100% 0.264 0.158 N KAZN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001370230.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02742 pDONR223 100% 77.2% 71.3% None 1_87del;847_848insGCAAC;912_913ins151 n/a
2 ccsbBroad304_02742 pLX_304 0% 77.2% 71.3% V5 1_87del;847_848insGCAAC;912_913ins151 n/a
3 TRCN0000465891 AAGTTGCACTGGAGATTTACGACA pLX_317 31.3% 77.2% 71.3% V5 1_87del;847_848insGCAAC;912_913ins151 n/a
Download CSV