Transcript: Human NM_145185.4

Homo sapiens mitogen-activated protein kinase kinase 7 (MAP2K7), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
MAP2K7 (5609)
Length:
3375
CDS:
69..1328

Additional Resources:

NCBI RefSeq record:
NM_145185.4
NBCI Gene record:
MAP2K7 (5609)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_145185.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380835 CGTCATTGCCGTTAAGCAAAT pLKO_005 500 CDS 100% 10.800 15.120 N MAP2K7 n/a
2 TRCN0000321014 GTCAAAGACTGCCTTACTAAA pLKO_005 1137 CDS 100% 13.200 9.240 N Map2k7 n/a
3 TRCN0000350455 GTCAAAGACTGCCTTACTAAA pLKO_005 1137 CDS 100% 13.200 9.240 N MAP2K7 n/a
4 TRCN0000315338 AGAACTGCAAGACGGACTTTG pLKO_005 1036 CDS 100% 10.800 7.560 N MAP2K7 n/a
5 TRCN0000360372 AGAACTGCAAGACGGACTTTG pLKO_005 1036 CDS 100% 10.800 7.560 N Map2k7 n/a
6 TRCN0000315390 GATCAGAGTCGCTGTTCATTC pLKO_005 1581 3UTR 100% 10.800 7.560 N MAP2K7 n/a
7 TRCN0000001079 CACAGGAAGAGACCAAAGTAT pLKO.1 1161 CDS 100% 5.625 3.938 N MAP2K7 n/a
8 TRCN0000196556 GCAAATCAAGTGGACAAGAAA pLKO.1 2625 3UTR 100% 5.625 3.938 N MAP2K7 n/a
9 TRCN0000195695 CAAGATGACAGTGGCGATTGT pLKO.1 728 CDS 100% 4.950 3.465 N MAP2K7 n/a
10 TRCN0000010586 CCCTACATCGTGCAGTGCTTT pLKO.1 597 CDS 100% 4.950 3.465 N MAP2K7 n/a
11 TRCN0000010588 GATTGTGAAGGCGCTGTACTA pLKO.1 743 CDS 100% 4.950 3.465 N MAP2K7 n/a
12 TRCN0000350516 GATTGTGAAGGCGCTGTACTA pLKO_005 743 CDS 100% 4.950 3.465 N MAP2K7 n/a
13 TRCN0000380424 CAGACACTGTGAACGGAAGAC pLKO_005 1550 3UTR 100% 4.050 2.835 N MAP2K7 n/a
14 TRCN0000010587 GAGCATTGAGATTGACCAGAA pLKO.1 332 CDS 100% 4.050 2.835 N MAP2K7 n/a
15 TRCN0000315389 GAGCATTGAGATTGACCAGAA pLKO_005 332 CDS 100% 4.050 2.835 N MAP2K7 n/a
16 TRCN0000001080 CTACAAGAACTGCAAGACGGA pLKO.1 1031 CDS 100% 0.660 0.462 N MAP2K7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145185.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14811 pDONR223 0% 98.2% 98.3% None 51G>A;573C>T;935_936ins21 n/a
2 ccsbBroad304_14811 pLX_304 0% 98.2% 98.3% V5 51G>A;573C>T;935_936ins21 n/a
3 TRCN0000479770 GCAAAGCTAGGTTCCCCTATATCG pLX_317 26% 98.1% 98.1% V5 (many diffs) n/a
4 TRCN0000488353 GCTTAAACCCCCTGTGTGAACCAC pLX_317 26% 98.2% 98.3% V5 (not translated due to prior stop codon) 51G>A;573C>T;935_936ins21 n/a
Download CSV