Transcript: Human NM_004888.4

Homo sapiens ATPase H+ transporting V1 subunit G1 (ATP6V1G1), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
ATP6V1G1 (9550)
Length:
1563
CDS:
71..427

Additional Resources:

NCBI RefSeq record:
NM_004888.4
NBCI Gene record:
ATP6V1G1 (9550)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004888.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000038614 CCAGACATACTTCCGGCAGAA pLKO.1 322 CDS 100% 4.050 5.670 N ATP6V1G1 n/a
2 TRCN0000312649 TACCGCATAAATGGATAGAAG pLKO_005 410 CDS 100% 0.000 0.000 N ATP6V1G1 n/a
3 TRCN0000038615 GAAGAAGCTCAGGCTGAAATT pLKO.1 182 CDS 100% 13.200 9.240 N ATP6V1G1 n/a
4 TRCN0000327872 GAAGAAGCTCAGGCTGAAATT pLKO_005 182 CDS 100% 13.200 9.240 N ATP6V1G1 n/a
5 TRCN0000312648 TTTAGATGCCCTCACGAATAT pLKO_005 460 3UTR 100% 13.200 9.240 N ATP6V1G1 n/a
6 TRCN0000312647 ACCATCCTCCAGACATACTTC pLKO_005 314 CDS 100% 4.950 3.465 N ATP6V1G1 n/a
7 TRCN0000038618 GATGACCATCCTCCAGACATA pLKO.1 310 CDS 100% 4.950 3.465 N ATP6V1G1 n/a
8 TRCN0000038616 TCTGTGACATTCGGCCAGAAA pLKO.1 378 CDS 100% 4.950 3.465 N ATP6V1G1 n/a
9 TRCN0000038617 GCAGAGGGAGAAAGAATTCAA pLKO.1 217 CDS 100% 0.000 0.000 N ATP6V1G1 n/a
10 TRCN0000327873 GCAGAGGGAGAAAGAATTCAA pLKO_005 217 CDS 100% 0.000 0.000 N ATP6V1G1 n/a
11 TRCN0000101529 CGGAGGCTGAAGCAGGCCAAA pLKO.1 161 CDS 100% 0.000 0.000 Y Atp6v1g1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004888.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07443 pDONR223 100% 99.7% 100% None 345C>T n/a
2 ccsbBroad304_07443 pLX_304 0% 99.7% 100% V5 345C>T n/a
3 TRCN0000478630 GTTCACCTTGATCCTGGTGCCAGA pLX_317 100% 99.7% 100% V5 345C>T n/a
4 ccsbBroadEn_11388 pDONR223 100% 71.1% 71.1% None 253_354del n/a
5 ccsbBroad304_11388 pLX_304 0% 71.1% 71.1% V5 253_354del n/a
Download CSV