Transcript: Human NM_001030019.2

Homo sapiens Sad1 and UNC84 domain containing 3 (SUN3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
SUN3 (256979)
Length:
1425
CDS:
170..1243

Additional Resources:

NCBI RefSeq record:
NM_001030019.2
NBCI Gene record:
SUN3 (256979)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001030019.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244091 GTGTCAAACTTGGTCAATTAT pLKO_005 665 CDS 100% 15.000 12.000 N SUN3 n/a
2 TRCN0000244093 CCAGACTTCGTATGCCTAAAG pLKO_005 459 CDS 100% 10.800 8.640 N SUN3 n/a
3 TRCN0000244094 ACTCGATCATGGAAGATTATT pLKO_005 296 CDS 100% 15.000 10.500 N SUN3 n/a
4 TRCN0000244090 ATATGGTTCAAGGCTTTATAA pLKO_005 430 CDS 100% 15.000 10.500 N SUN3 n/a
5 TRCN0000244092 CCATGCCACATGTCCAGAATA pLKO_005 1262 3UTR 100% 13.200 9.240 N SUN3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001030019.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13477 pDONR223 100% 85.3% 85.1% None 1_156del;379A>G n/a
2 ccsbBroad304_13477 pLX_304 0% 85.3% 85.1% V5 1_156del;379A>G n/a
3 TRCN0000469752 ATTAATGTGCACAAGCTCACAGGT pLX_317 45.4% 85.3% 85.1% V5 1_156del;379A>G n/a
Download CSV