Transcript: Human XR_001738688.2

PREDICTED: Homo sapiens ALK receptor tyrosine kinase (ALK), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ALK (238)
Length:
4104
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001738688.2
NBCI Gene record:
ALK (238)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001738688.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000199629 GCAGAATACAGCACCCAAATC pLKO.1 2865 3UTR 100% 10.800 15.120 N ALK n/a
2 TRCN0000422093 GTGGAGCCACCTACGTATTTA pLKO_005 3395 3UTR 100% 15.000 10.500 N ALK n/a
3 TRCN0000418856 AGCCCTCTGGAAGGTACATTG pLKO_005 1997 3UTR 100% 10.800 7.560 N ALK n/a
4 TRCN0000432650 TCTAGGGCTAAACGGCAATTC pLKO_005 3531 3UTR 100% 10.800 7.560 N ALK n/a
5 TRCN0000000787 AGAAGAAGAAATCCGTGTGAA pLKO.1 3333 3UTR 100% 4.950 3.465 N ALK n/a
6 TRCN0000000788 CTGGTCATAGCTCCTTGGAAT pLKO.1 1595 3UTR 100% 4.950 3.465 N ALK n/a
7 TRCN0000000786 ACCCAAATCAAGAAACCTGTT pLKO.1 2877 3UTR 100% 4.050 2.835 N ALK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001738688.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14540 pDONR223 0% 54.8% None 1_930del;3670_3671ins74;4104_4105ins1612 n/a
2 ccsbBroad304_14540 pLX_304 0% 54.8% V5 1_930del;3670_3671ins74;4104_4105ins1612 n/a
3 TRCN0000469859 GAGCGTGGTCCCCGGCAGTTAAGG pLX_317 8.4% 54.8% V5 1_930del;3670_3671ins74;4104_4105ins1612 n/a
Download CSV