Transcript: Human NM_148957.4

Homo sapiens TNF receptor superfamily member 19 (TNFRSF19), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
TNFRSF19 (55504)
Length:
4438
CDS:
472..1725

Additional Resources:

NCBI RefSeq record:
NM_148957.4
NBCI Gene record:
TNFRSF19 (55504)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_148957.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000058886 GCTCAACGTCTTTGGATTCAA pLKO.1 1499 CDS 100% 5.625 7.875 N TNFRSF19 n/a
2 TRCN0000058884 GCATCAACTCAGGATGCACTA pLKO.1 1627 CDS 100% 0.405 0.567 N TNFRSF19 n/a
3 TRCN0000058883 CTAGGCTATTTGTCATGTAAA pLKO.1 529 CDS 100% 13.200 9.240 N TNFRSF19 n/a
4 TRCN0000058887 CATCTATTGTAAGAGACAGTT pLKO.1 1041 CDS 100% 4.950 3.465 N TNFRSF19 n/a
5 TRCN0000058885 GCATGGAGTTGTCTAAGGAAT pLKO.1 635 CDS 100% 4.950 3.465 N TNFRSF19 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_148957.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03594 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03594 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000476306 GAACGTAACCCTTACGGTTGGCGA pLX_317 27.5% 100% 100% V5 n/a
Download CSV