Transcript: Human XM_006715072.4

PREDICTED: Homo sapiens glutathione S-transferase alpha 3 (GSTA3), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GSTA3 (2940)
Length:
765
CDS:
87..605

Additional Resources:

NCBI RefSeq record:
XM_006715072.4
NBCI Gene record:
GSTA3 (2940)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006715072.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417304 GACATTAGCCTGGTGGAACTT pLKO_005 405 CDS 100% 4.950 3.465 N GSTA3 n/a
2 TRCN0000123274 GCTAAGAACATGCAAGACCAA pLKO.1 622 3UTR 100% 2.640 1.848 N GSTA3 n/a
3 TRCN0000123277 AGAAGGTATGGCAGATTTGAA pLKO.1 224 CDS 100% 5.625 2.813 Y GSTA3 n/a
4 TRCN0000123275 GTATGGCAGATTTGAATGAAA pLKO.1 229 CDS 100% 5.625 2.813 Y GSTA3 n/a
5 TRCN0000438316 CCAGAGCCATTCTCAACTACA pLKO_005 139 CDS 100% 4.950 2.475 Y Gsta2 n/a
6 TRCN0000155838 CTCAACTACATTGCCAGCAAA pLKO.1 150 CDS 100% 4.950 2.475 Y GSTA2 n/a
7 TRCN0000161712 GCAAGTACCAATGGTTGAGAT pLKO.1 95 CDS 100% 4.950 2.475 Y GSTA5 n/a
8 TRCN0000123276 CATGGACAAGACTACCTTGTT pLKO.1 363 CDS 100% 0.495 0.248 Y GSTA3 n/a
9 TRCN0000160709 CATGGACAAGACTACCTTGTT pLKO.1 363 CDS 100% 0.495 0.248 Y GSTA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006715072.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00701 pDONR223 100% 72% 71.1% None (many diffs) n/a
2 ccsbBroad304_00701 pLX_304 0% 72% 71.1% V5 (many diffs) n/a
3 TRCN0000469010 TTTTTAGACCATACGTGGGATTTT pLX_317 51.7% 72% 71.1% V5 (many diffs) n/a
4 ccsbBroadEn_06330 pDONR223 100% 71.4% 69.3% None (many diffs) n/a
5 ccsbBroad304_06330 pLX_304 0% 71.4% 69.3% V5 (many diffs) n/a
6 TRCN0000467221 TTACCGAGATCTCTTTTCATATCT pLX_317 52.1% 71.4% 69.3% V5 (many diffs) n/a
Download CSV