Transcript: Human XM_011520239.3

PREDICTED: Homo sapiens leucine rich repeat containing 4C (LRRC4C), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LRRC4C (57689)
Length:
10206
CDS:
980..2902

Additional Resources:

NCBI RefSeq record:
XM_011520239.3
NBCI Gene record:
LRRC4C (57689)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011520239.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000161916 GCTCAGTGATGGTACGTTAAA pLKO.1 2194 CDS 100% 13.200 18.480 N LRRC4C n/a
2 TRCN0000159200 GCGGATACATTTACATCACAA pLKO.1 1861 CDS 100% 4.950 6.930 N LRRC4C n/a
3 TRCN0000164499 CGTCTTACTACCATCCCGAAT pLKO.1 1382 CDS 100% 4.050 5.670 N LRRC4C n/a
4 TRCN0000160849 GAGGTATTTGAACCTTGCCAT pLKO.1 1576 CDS 100% 2.640 3.696 N LRRC4C n/a
5 TRCN0000160909 GCACTTGAGACACTTGGAAAT pLKO.1 1270 CDS 100% 10.800 7.560 N LRRC4C n/a
6 TRCN0000160450 CAGAATTACTTCACATGCTAT pLKO.1 2015 CDS 100% 4.950 3.465 N LRRC4C n/a
7 TRCN0000108457 CCGAATGAACTCTAAAGACAA pLKO.1 2860 CDS 100% 4.950 3.465 N Lrrc4c n/a
8 TRCN0000160498 CCGAATGAACTCTAAAGACAA pLKO.1 2860 CDS 100% 4.950 3.465 N LRRC4C n/a
9 TRCN0000108458 CCCAGGAATTGATGAGGTCAT pLKO.1 2527 CDS 100% 4.050 2.835 N Lrrc4c n/a
10 TRCN0000164017 CCGTTGGGAATACTACTGCTT pLKO.1 2271 CDS 100% 2.640 1.848 N LRRC4C n/a
11 TRCN0000160566 CAACAAGGACTGTTGAAATTA pLKO.1 2664 CDS 100% 1.500 1.050 N LRRC4C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011520239.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10463 pDONR223 100% 99.3% 99.3% None 1_12del;963C>G n/a
2 ccsbBroad304_10463 pLX_304 0% 99.3% 99.3% V5 1_12del;963C>G n/a
3 TRCN0000492330 GGCAGCCTCATTCGGAGGATCGTC pLX_317 21.7% 99.3% 99.3% V5 1_12del;963C>G n/a
Download CSV