Transcript: Human NM_001163940.2

Homo sapiens glycogen phosphorylase L (PYGL), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
PYGL (5836)
Length:
2697
CDS:
81..2522

Additional Resources:

NCBI RefSeq record:
NM_001163940.2
NBCI Gene record:
PYGL (5836)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001163940.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000119084 GCAAGATATCATCCGCCGTTT pLKO.1 893 CDS 100% 4.050 5.670 N PYGL n/a
2 TRCN0000296148 CACGATGTACAACCGCATTAA pLKO_005 1733 CDS 100% 13.200 10.560 N PYGL n/a
3 TRCN0000296096 TATCCAATGAATCTAACAAAG pLKO_005 2488 CDS 100% 10.800 7.560 N PYGL n/a
4 TRCN0000119085 CCTATGTCAAGTGTCAAGATA pLKO.1 2317 CDS 100% 5.625 3.938 N PYGL n/a
5 TRCN0000119086 CCTCGACATTTGGAAATCATT pLKO.1 1170 CDS 100% 5.625 3.938 N PYGL n/a
6 TRCN0000119082 GCCTATGTCAAGTGTCAAGAT pLKO.1 2316 CDS 100% 4.950 3.465 N PYGL n/a
7 TRCN0000307010 GCCTATGTCAAGTGTCAAGAT pLKO_005 2316 CDS 100% 4.950 3.465 N PYGL n/a
8 TRCN0000119083 CCAGGATATCACATGGCCAAA pLKO.1 1812 CDS 100% 4.050 2.835 N PYGL n/a
9 TRCN0000307008 CCAGGATATCACATGGCCAAA pLKO_005 1812 CDS 100% 4.050 2.835 N PYGL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001163940.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01355 pDONR223 100% 95.9% 95.9% None 241_242ins102 n/a
2 ccsbBroad304_01355 pLX_304 0% 95.9% 95.9% V5 241_242ins102 n/a
3 TRCN0000477544 TTAGAGCATCTCGACTCCTCAAGG pLX_317 20.6% 95.9% 95.9% V5 241_242ins102 n/a
Download CSV