Transcript: Human NM_015336.3

Homo sapiens zinc finger DHHC-type containing 17 (ZDHHC17), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
ZDHHC17 (23390)
Length:
4793
CDS:
164..2062

Additional Resources:

NCBI RefSeq record:
NM_015336.3
NBCI Gene record:
ZDHHC17 (23390)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015336.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230357 GGTGCAGGCAACCATAGATAT pLKO_005 1586 CDS 100% 13.200 18.480 N ZDHHC17 n/a
2 TRCN0000230356 ATGTACGGCAACCGGACAAAG pLKO_005 408 CDS 100% 10.800 15.120 N ZDHHC17 n/a
3 TRCN0000133990 CCAGGCAGTATACAATAGAAT pLKO.1 2004 CDS 100% 5.625 7.875 N ZDHHC17 n/a
4 TRCN0000230359 CTGTTGCAATGCTGATATATT pLKO_005 2658 3UTR 100% 15.000 12.000 N ZDHHC17 n/a
5 TRCN0000230358 GATATCATGTTTAGGTATTAC pLKO_005 1828 CDS 100% 13.200 10.560 N ZDHHC17 n/a
6 TRCN0000133873 CCAACTATAAACCCAGTTCTA pLKO.1 4381 3UTR 100% 4.950 3.960 N ZDHHC17 n/a
7 TRCN0000218639 ATGATCTGCTGGATGATTTAT pLKO_005 1637 CDS 100% 15.000 10.500 N ZDHHC17 n/a
8 TRCN0000134447 GCTGCCATCAATAACAGAATA pLKO.1 452 CDS 100% 13.200 9.240 N ZDHHC17 n/a
9 TRCN0000136306 GCATGTCTGATGCTTGGTAAA pLKO.1 3610 3UTR 100% 10.800 7.560 N ZDHHC17 n/a
10 TRCN0000138337 CCACAAGACAAGGCCATCTAT pLKO.1 555 CDS 100% 5.625 3.938 N ZDHHC17 n/a
11 TRCN0000125111 GCCATCAATAACAGAATAGAT pLKO.1 455 CDS 100% 5.625 3.938 N Zdhhc17 n/a
12 TRCN0000134019 CAGTACCTGTTTGATACGAAA pLKO.1 1480 CDS 100% 4.950 3.465 N ZDHHC17 n/a
13 TRCN0000137952 GCAGGGAATACCACAGTCATT pLKO.1 866 CDS 100% 4.950 3.465 N ZDHHC17 n/a
14 TRCN0000134346 GCTGACAGTATATTCTGGTTT pLKO.1 3076 3UTR 100% 4.950 3.465 N ZDHHC17 n/a
15 TRCN0000138466 CCCAGAATATCAAGGGCGAAT pLKO.1 921 CDS 100% 4.050 2.835 N ZDHHC17 n/a
16 TRCN0000138338 CATGGGACATAGTCAAGGCTA pLKO.1 336 CDS 100% 2.640 1.848 N ZDHHC17 n/a
17 TRCN0000136360 CACTTACACCAAGGATGGATT pLKO.1 1693 CDS 100% 4.950 2.970 N ZDHHC17 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015336.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02758 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02758 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000478337 GCGGGATGTCCACCTATTATAATA pLX_317 16.6% 100% 100% V5 n/a
Download CSV