Transcript: Human NM_178273.2

Homo sapiens paired immunoglobin like type 2 receptor alpha (PILRA), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
PILRA (29992)
Length:
1018
CDS:
171..698

Additional Resources:

NCBI RefSeq record:
NM_178273.2
NBCI Gene record:
PILRA (29992)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_178273.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000061073 CCCAAGCTAAATCCCAAGGAT pLKO.1 689 CDS 100% 3.000 2.400 N PILRA n/a
2 TRCN0000373203 ACAGCTCCCGACGTGAGAATA pLKO_005 357 CDS 100% 13.200 9.240 N PILRA n/a
3 TRCN0000373204 CAGCCCTCTCAAGACTGAATG pLKO_005 838 3UTR 100% 10.800 7.560 N PILRA n/a
4 TRCN0000061075 GACCCTGTACTCTGTCTTAAA pLKO.1 802 3UTR 100% 13.200 7.920 N PILRA n/a
5 TRCN0000061076 GCCATATGAGAATATCAGGAA pLKO.1 649 CDS 100% 0.000 0.000 N PILRA n/a
6 TRCN0000060994 CGCCTTCCATTCACAAGGATT pLKO.1 427 CDS 100% 4.950 2.475 Y PILRB n/a
7 TRCN0000291328 CGCCTTCCATTCACAAGGATT pLKO_005 427 CDS 100% 4.950 2.475 Y PILRB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178273.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11917 pDONR223 100% 77.1% 64.8% None (many diffs) n/a
2 ccsbBroad304_11917 pLX_304 0% 77.1% 64.8% V5 (many diffs) n/a
3 TRCN0000469178 CCATAGGATGCTTCTATGACCCAT pLX_317 49.5% 77.1% 64.8% V5 (many diffs) n/a
4 ccsbBroadEn_03124 pDONR223 100% 68% 62.3% None (many diffs) n/a
5 ccsbBroad304_03124 pLX_304 0% 68% 62.3% V5 (many diffs) n/a
6 TRCN0000469374 ATCCCAATCCGCCCCATCTCATAC pLX_317 64% 68% 62.3% V5 (many diffs) n/a
Download CSV