Transcript: Human XM_011514790.2

PREDICTED: Homo sapiens zinc finger AN1-type containing 3 (ZFAND3), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZFAND3 (60685)
Length:
2916
CDS:
166..681

Additional Resources:

NCBI RefSeq record:
XM_011514790.2
NBCI Gene record:
ZFAND3 (60685)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011514790.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000004583 GACAACAACAATACCTCGATA pLKO.1 364 CDS 100% 4.950 6.930 N ZFAND3 n/a
2 TRCN0000106377 TGAATGTAACTTCACCGAGTA pLKO.1 431 CDS 100% 4.050 5.670 N Zfand3 n/a
3 TRCN0000004584 CCAGTCCACATCTACCATATA pLKO.1 1742 3UTR 100% 13.200 10.560 N ZFAND3 n/a
4 TRCN0000427349 CACAGCTCATGTCTCATTAAT pLKO_005 477 CDS 100% 15.000 10.500 N ZFAND3 n/a
5 TRCN0000106375 CGCTGTTCTTAGTTCACTAAT pLKO.1 706 3UTR 100% 13.200 9.240 N Zfand3 n/a
6 TRCN0000106379 ACTATGAATCTCTGTTCCAAA pLKO.1 247 CDS 100% 4.950 3.465 N Zfand3 n/a
7 TRCN0000414527 ATGGTGAAGCTGGACCGGAAA pLKO_005 619 CDS 100% 4.050 2.835 N ZFAND3 n/a
8 TRCN0000106376 CAAGTACAAGTAACAGCCAAT pLKO.1 314 CDS 100% 4.050 2.835 N Zfand3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011514790.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03899 pDONR223 97.8% 75.3% 75.3% None 360_361ins168 n/a
2 ccsbBroad304_03899 pLX_304 0% 75.3% 75.3% V5 (not translated due to prior stop codon) 360_361ins168 n/a
3 TRCN0000473314 GATTCGATCCCTTGTCTCTCTAAG pLX_317 41.6% 75.3% 75.3% V5 (not translated due to prior stop codon) 360_361ins168 n/a
4 TRCN0000481283 GGAACTAAGGTCCTCACAGTTAAT pLX_317 50.2% 75.3% 75.3% V5 (not translated due to prior stop codon) 360_361ins168 n/a
Download CSV