Transcript: Human NM_001170580.3

Homo sapiens hedgehog acyltransferase (HHAT), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
HHAT (55733)
Length:
3554
CDS:
162..1643

Additional Resources:

NCBI RefSeq record:
NM_001170580.3
NBCI Gene record:
HHAT (55733)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001170580.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422901 TTGATGTTGGACTGCATAATT pLKO_005 1174 CDS 100% 15.000 21.000 N HHAT n/a
2 TRCN0000422181 CACTTTATTTGGAGGATTAAA pLKO_005 296 CDS 100% 15.000 12.000 N HHAT n/a
3 TRCN0000422431 ACTGGATGCTGGATCTCATAG pLKO_005 1775 3UTR 100% 10.800 7.560 N HHAT n/a
4 TRCN0000035599 CCCTGGATTCTCATGCTCTAT pLKO.1 441 CDS 100% 4.950 3.465 N HHAT n/a
5 TRCN0000035601 CGTGAGCACCATGTTCAGTTT pLKO.1 1133 CDS 100% 4.950 3.465 N HHAT n/a
6 TRCN0000035600 GCCACATGGTAGTGTCTCAAA pLKO.1 391 CDS 100% 4.950 3.465 N HHAT n/a
7 TRCN0000035602 GCTCCATACCACCATCTCTTT pLKO.1 515 CDS 100% 4.950 3.465 N HHAT n/a
8 TRCN0000035603 TCTTCATACAAGGCTGGCCTT pLKO.1 1540 CDS 100% 2.160 1.512 N HHAT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001170580.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08572 pDONR223 100% 99.8% 99.7% None 534G>C;545G>A n/a
2 ccsbBroad304_08572 pLX_304 0% 99.8% 99.7% V5 534G>C;545G>A n/a
3 TRCN0000475311 ACGTCTAAACTGCGCTGTATTCCT pLX_317 22.3% 99.8% 99.7% V5 534G>C;545G>A n/a
Download CSV