Transcript: Human XM_005251510.5

PREDICTED: Homo sapiens plasminogen receptor with a C-terminal lysine (PLGRKT), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PLGRKT (55848)
Length:
1176
CDS:
460..903

Additional Resources:

NCBI RefSeq record:
XM_005251510.5
NBCI Gene record:
PLGRKT (55848)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005251510.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000127520 CTTTAACAGCTGGAGCGATTA pLKO.1 659 CDS 100% 10.800 15.120 N PLGRKT n/a
2 TRCN0000130078 CCGATTGTTCCATTAAGCTTT pLKO.1 706 CDS 100% 4.950 6.930 N PLGRKT n/a
3 TRCN0000343097 CCGATTGTTCCATTAAGCTTT pLKO_005 706 CDS 100% 4.950 6.930 N PLGRKT n/a
4 TRCN0000130738 GCTTATGAATGCTCGACTTCA pLKO.1 519 CDS 100% 4.950 6.930 N PLGRKT n/a
5 TRCN0000352746 GCTTATGAATGCTCGACTTCA pLKO_005 519 CDS 100% 4.950 6.930 N PLGRKT n/a
6 TRCN0000128721 CCAATCAAATCTCAAAGCACA pLKO.1 915 3UTR 100% 2.640 2.112 N PLGRKT n/a
7 TRCN0000343099 CCAATCAAATCTCAAAGCACA pLKO_005 915 3UTR 100% 2.640 2.112 N PLGRKT n/a
8 TRCN0000129285 CCTCACCTACCAGTATGACTT pLKO.1 729 CDS 100% 4.950 3.465 N PLGRKT n/a
9 TRCN0000131229 GCCAGAAAGGAACAGAGTAGA pLKO.1 865 CDS 100% 4.950 3.465 N PLGRKT n/a
10 TRCN0000129518 GCTGAGGACATACTGGAAACA pLKO.1 787 CDS 100% 4.950 3.465 N PLGRKT n/a
11 TRCN0000343160 GCTGAGGACATACTGGAAACA pLKO_005 787 CDS 100% 4.950 3.465 N PLGRKT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005251510.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08598 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_08598 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000492048 AGCTAATAAACATTTGAACCATAA pLX_317 34.4% 100% 100% V5 n/a
Download CSV