Transcript: Human NM_002004.4

Homo sapiens farnesyl diphosphate synthase (FDPS), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
FDPS (2224)
Length:
1417
CDS:
102..1361

Additional Resources:

NCBI RefSeq record:
NM_002004.4
NBCI Gene record:
FDPS (2224)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002004.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000036297 CCAGCAGTGTTCTTGCAATAT pLKO.1 1230 CDS 100% 13.200 9.240 N FDPS n/a
2 TRCN0000299722 CCAGCAGTGTTCTTGCAATAT pLKO_005 1230 CDS 100% 13.200 9.240 N FDPS n/a
3 TRCN0000036294 CCCAGAGATAGGAGATGCTAT pLKO.1 404 CDS 100% 4.950 2.970 N FDPS n/a
4 TRCN0000299721 CCCAGAGATAGGAGATGCTAT pLKO_005 404 CDS 100% 4.950 2.970 N FDPS n/a
5 TRCN0000036295 GCCATGTACATGGCAGGAATT pLKO.1 936 CDS 100% 0.000 0.000 N FDPS n/a
6 TRCN0000299718 GCCATGTACATGGCAGGAATT pLKO_005 936 CDS 100% 0.000 0.000 N FDPS n/a
7 TRCN0000036298 GCAGGATTTCGTTCAGCACTT pLKO.1 341 CDS 100% 4.050 2.025 Y FDPS n/a
8 TRCN0000299719 GCAGGATTTCGTTCAGCACTT pLKO_005 341 CDS 100% 4.050 2.025 Y FDPS n/a
9 TRCN0000036296 GTCCTGGAGTACAATGCCATT pLKO.1 441 CDS 100% 4.050 2.025 Y FDPS n/a
10 TRCN0000310493 GTCCTGGAGTACAATGCCATT pLKO_005 441 CDS 100% 4.050 2.025 Y FDPS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002004.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00548 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00548 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000478886 ATGCCACGCACATGTGTTTGCCTC pLX_317 29.1% 100% 100% V5 n/a
4 TRCN0000488829 CACAGTTCCGAAGCCCGCAGAAGA pLX_317 27.9% 100% 100% V5 (not translated due to prior stop codon) n/a
5 TRCN0000491309 TGCTTGGCTGCTGCTTGCCCCTTC pLX_317 25% 99.9% 99.7% V5 1257_1258insG n/a
Download CSV