Transcript: Human NM_152632.4

Homo sapiens cilia and flagella associated protein 47 (CFAP47), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-01
Taxon:
Homo sapiens (human)
Gene:
CFAP47 (286464)
Length:
3611
CDS:
67..2997

Additional Resources:

NCBI RefSeq record:
NM_152632.4
NBCI Gene record:
CFAP47 (286464)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152632.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000167221 CGGCTACTTATTTCAATAGAA pLKO.1 418 CDS 100% 5.625 7.875 N CFAP47 n/a
2 TRCN0000168831 CGCAAGAATTATGCACCTGTA pLKO.1 1726 CDS 100% 4.050 5.670 N CFAP47 n/a
3 TRCN0000168634 GCCAGTGAAGGATATGCTATT pLKO.1 1800 CDS 100% 10.800 7.560 N CFAP47 n/a
4 TRCN0000167652 GAGATGCTCTTGAGTATCAAA pLKO.1 745 CDS 100% 5.625 3.938 N CFAP47 n/a
5 TRCN0000168579 GCAGCTTAATGTTGACACCAA pLKO.1 2276 CDS 100% 2.640 1.584 N CFAP47 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152632.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14424 pDONR223 100% 76.9% 76.7% None (many diffs) n/a
2 ccsbBroad304_14424 pLX_304 0% 76.9% 76.7% V5 (many diffs) n/a
3 TRCN0000471143 TTCTTACTATCCCATGCCCGGGTT pLX_317 20.4% 76.9% 76.7% V5 (many diffs) n/a
Download CSV