Transcript: Mouse XM_011249416.3

PREDICTED: Mus musculus metal response element binding transcription factor 2 (Mtf2), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Mtf2 (17765)
Length:
4047
CDS:
511..1986

Additional Resources:

NCBI RefSeq record:
XM_011249416.3
NBCI Gene record:
Mtf2 (17765)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011249416.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000303893 CATGTAGATAGCACAAGTATT pLKO_005 2362 3UTR 100% 13.200 18.480 N MTF2 n/a
2 TRCN0000245034 CCGTTACAGTGGGTAGATATA pLKO_005 991 CDS 100% 13.200 18.480 N Mtf2 n/a
3 TRCN0000086136 CTACCGTTACAGTGGGTAGAT pLKO.1 988 CDS 100% 0.495 0.693 N Mtf2 n/a
4 TRCN0000245035 GCATGTTCTGGAGGCATTAAA pLKO_005 1158 CDS 100% 15.000 10.500 N Mtf2 n/a
5 TRCN0000303983 GCATGTTCTGGAGGCATTAAA pLKO_005 1158 CDS 100% 15.000 10.500 N MTF2 n/a
6 TRCN0000245033 GGCCCTGGAGACTGGTATTTA pLKO_005 826 CDS 100% 15.000 10.500 N Mtf2 n/a
7 TRCN0000086133 GCCTGCTGCAATACCACATTT pLKO.1 1671 CDS 100% 13.200 9.240 N Mtf2 n/a
8 TRCN0000257182 GGAGTATATATCCCATAATTC pLKO_005 2673 3UTR 100% 13.200 9.240 N Mtf2 n/a
9 TRCN0000245032 TCCCAATGAAATGGTTATATG pLKO_005 549 CDS 100% 13.200 9.240 N Mtf2 n/a
10 TRCN0000303915 TCCCAATGAAATGGTTATATG pLKO_005 549 CDS 100% 13.200 9.240 N MTF2 n/a
11 TRCN0000086135 GCGCTTAAGAAAGGACCAAAT pLKO.1 697 CDS 100% 10.800 7.560 N Mtf2 n/a
12 TRCN0000086137 CCACCAAATGTGGCTTTCAAA pLKO.1 1264 CDS 100% 5.625 3.938 N Mtf2 n/a
13 TRCN0000107683 GTGTGATTGATTCAGATGAAA pLKO.1 626 CDS 100% 5.625 3.938 N MTF2 n/a
14 TRCN0000086134 CGTTGGATTTACCTTGTTCTA pLKO.1 1499 CDS 100% 4.950 3.465 N Mtf2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011249416.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02688 pDONR223 100% 69.5% 71.5% None (many diffs) n/a
2 ccsbBroad304_02688 pLX_304 0% 69.5% 71.5% V5 (many diffs) n/a
Download CSV