Transcript: Mouse NM_025812.3

Mus musculus high mobility group 20A (Hmg20a), mRNA.

Source:
NCBI, updated 2019-08-02
Taxon:
Mus musculus (mouse)
Gene:
Hmg20a (66867)
Length:
3768
CDS:
318..1358

Additional Resources:

NCBI RefSeq record:
NM_025812.3
NBCI Gene record:
Hmg20a (66867)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025812.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000337818 GTGAACAGGCTTGATCGTTAA pLKO_005 1338 CDS 100% 10.800 15.120 N Hmg20a n/a
2 TRCN0000115114 TCCCTATATTTACCGAAGAAT pLKO.1 967 CDS 100% 5.625 7.875 N Hmg20a n/a
3 TRCN0000115115 CGTAAATCCAACATGGAGTTT pLKO.1 1032 CDS 100% 4.950 6.930 N Hmg20a n/a
4 TRCN0000337746 CGTAAATCCAACATGGAGTTT pLKO_005 1032 CDS 100% 4.950 6.930 N Hmg20a n/a
5 TRCN0000337817 GAACAGATTGCACAGTATAAT pLKO_005 1265 CDS 100% 15.000 10.500 N Hmg20a n/a
6 TRCN0000337748 TGGGCAATGAGTGGAGTAAAC pLKO_005 724 CDS 100% 10.800 7.560 N Hmg20a n/a
7 TRCN0000115113 CCTTACAGGATATGTTCGATT pLKO.1 632 CDS 100% 4.950 3.465 N Hmg20a n/a
8 TRCN0000115112 CCCTATATTTACCGAAGAATT pLKO.1 968 CDS 100% 0.000 0.000 N Hmg20a n/a
9 TRCN0000115111 CCCTCTCCTTACTAAGGAATT pLKO.1 2427 3UTR 100% 0.000 0.000 N Hmg20a n/a
10 TRCN0000337816 CCCTCTCCTTACTAAGGAATT pLKO_005 2427 3UTR 100% 0.000 0.000 N Hmg20a n/a
11 TRCN0000015581 GTGGACACCATTGACTCATAT pLKO.1 1242 CDS 100% 13.200 9.240 N HMG20A n/a
12 TRCN0000285558 GTGGACACCATTGACTCATAT pLKO_005 1242 CDS 100% 13.200 9.240 N HMG20A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025812.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02409 pDONR223 100% 91.3% 95.9% None (many diffs) n/a
2 ccsbBroad304_02409 pLX_304 0% 91.3% 95.9% V5 (many diffs) n/a
Download CSV