Transcript: Mouse XM_001473957.5

PREDICTED: Mus musculus nuclear transport factor 2, pseudogene 2 (Nutf2-ps2), mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nutf2-ps2 (621832)
Length:
694
CDS:
75..458

Additional Resources:

NCBI RefSeq record:
XM_001473957.5
NBCI Gene record:
Nutf2-ps2 (621832)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_001473957.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079796 CCCAACTAGGCGCAATTTATA pLKO.1 154 CDS 100% 15.000 7.500 Y Nutf2 n/a
2 TRCN0000038552 GAACCCAACTAGGCGCAATTT pLKO.1 151 CDS 100% 13.200 6.600 Y NUTF2 n/a
3 TRCN0000300236 GAACCCAACTAGGCGCAATTT pLKO_005 151 CDS 100% 13.200 6.600 Y NUTF2 n/a
4 TRCN0000038553 GATGCTTGGGTTTGCACCAAT pLKO.1 402 CDS 100% 4.950 2.475 Y NUTF2 n/a
5 TRCN0000333495 GATGCTTGGGTTTGCACCAAT pLKO_005 402 CDS 100% 4.950 2.475 Y NUTF2 n/a
6 TRCN0000079793 GCTCCAAATATCATACACAAA pLKO.1 526 3UTR 100% 4.950 2.475 Y Nutf2 n/a
7 TRCN0000038550 ACATCAACGATGCTTGGGTTT pLKO.1 394 CDS 100% 4.050 2.025 Y NUTF2 n/a
8 TRCN0000333504 ACATCAACGATGCTTGGGTTT pLKO_005 394 CDS 100% 4.050 2.025 Y NUTF2 n/a
9 TRCN0000185068 CTACCAGTTATTTGATAACGA pLKO.1 128 CDS 100% 3.000 1.500 Y NUTF2P4 n/a
10 TRCN0000079794 GCGCAATTTATATTGATGCAT pLKO.1 163 CDS 100% 3.000 1.500 Y Nutf2 n/a
11 TRCN0000038551 AGATAGCTGCATCATCAGCAT pLKO.1 305 CDS 100% 2.640 1.320 Y NUTF2 n/a
12 TRCN0000333562 AGATAGCTGCATCATCAGCAT pLKO_005 305 CDS 100% 2.640 1.320 Y NUTF2 n/a
13 TRCN0000079797 GAAGCTATCTAGCCTTCCGTT pLKO.1 236 CDS 100% 2.640 1.320 Y Nutf2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_001473957.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02352 pDONR223 100% 93.9% 100% None (many diffs) n/a
2 ccsbBroad304_02352 pLX_304 0% 93.9% 100% V5 (many diffs) n/a
3 TRCN0000471183 GCCTTTTACTTTGTGCATCCCTAC pLX_317 98.5% 93.9% 100% V5 (many diffs) n/a
Download CSV