Transcript: Mouse XM_003085302.1

PREDICTED: Mus musculus predicted gene 15266 (Gm15266), mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gm15266 (100046078)
Length:
207
CDS:
1..207

Additional Resources:

NCBI RefSeq record:
XM_003085302.1
NBCI Gene record:
Gm15266 (100046078)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_003085302.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000273514 ATTCCAGAAGATTGCCATGGC pLKO_005 96 CDS 100% 2.160 1.080 Y SEC61G n/a
2 TRCN0000005538 CATTGGCTTCTTTGTGAAATT pLKO.1 147 CDS 100% 13.200 7.920 N SEC61G n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_003085302.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02776 pDONR223 100% 89.7% 86.7% None (many diffs) n/a
2 ccsbBroad304_02776 pLX_304 0% 89.7% 86.7% V5 (many diffs) n/a
3 TRCN0000466863 AATTTTGGCGTTCCAACTTCGCGC pLX_317 100% 89.7% 86.7% V5 (many diffs) n/a
Download CSV