Transcript: Human XM_005245046.3

PREDICTED: Homo sapiens flavin containing dimethylaniline monoxygenase 4 (FMO4), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FMO4 (2329)
Length:
2166
CDS:
434..1921

Additional Resources:

NCBI RefSeq record:
XM_005245046.3
NBCI Gene record:
FMO4 (2329)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005245046.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232502 ATCGGCCTTATCGGCCTTAAA pLKO_005 1346 CDS 100% 13.200 18.480 N FMO4 n/a
2 TRCN0000064506 CGGCCTTAAAGGATCCATCTT pLKO.1 1357 CDS 100% 4.950 3.960 N FMO4 n/a
3 TRCN0000257249 TCATGAGGATTATGGATTAAG pLKO_005 1039 CDS 100% 13.200 9.240 N FMO4 n/a
4 TRCN0000064505 GACAGAACATTGAAACCTTTA pLKO.1 1715 CDS 100% 10.800 7.560 N FMO4 n/a
5 TRCN0000064507 GAGATAAACTACAGGACAGAA pLKO.1 1866 CDS 100% 4.950 3.465 N FMO4 n/a
6 TRCN0000064504 GCGTGATTGAATTTACAGAAA pLKO.1 1146 CDS 100% 4.950 3.465 N FMO4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005245046.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10429 pDONR223 100% 88.5% 88.5% None 132_133ins189;1479_1480delGC n/a
2 ccsbBroad304_10429 pLX_304 0% 88.5% 88.5% V5 (not translated due to frame shift) 132_133ins189;1479_1480delGC n/a
3 TRCN0000477155 CGTCGACTTCACATCGCGCGATCT pLX_317 22.5% 88.5% 88.5% V5 (not translated due to prior stop codon) 132_133ins189;1479_1480delGC n/a
Download CSV