Transcript: Human XM_005245510.3

PREDICTED: Homo sapiens sorting nexin 27 (SNX27), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SNX27 (81609)
Length:
6037
CDS:
58..1374

Additional Resources:

NCBI RefSeq record:
XM_005245510.3
NBCI Gene record:
SNX27 (81609)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005245510.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245095 CAAATTAGCTGCACGTATATA pLKO_005 1773 3UTR 100% 15.000 21.000 N SNX27 n/a
2 TRCN0000245091 AGTACTACAGACCAAGTATAT pLKO_005 631 CDS 100% 13.200 18.480 N SNX27 n/a
3 TRCN0000245092 TACGTAAATTGGCACCTAATG pLKO_005 734 CDS 100% 10.800 15.120 N SNX27 n/a
4 TRCN0000005725 CACGCCATATTTCAATTACAT pLKO.1 1257 CDS 100% 5.625 7.875 N SNX27 n/a
5 TRCN0000005726 CAACGGTTACAGTCAGGGTTA pLKO.1 602 CDS 100% 4.050 5.670 N SNX27 n/a
6 TRCN0000005724 GTGTGTTCAATACGAGTAATT pLKO.1 484 CDS 100% 13.200 10.560 N SNX27 n/a
7 TRCN0000245093 ATGGCCTTCTGTTTCGAATAT pLKO_005 1198 CDS 100% 13.200 9.240 N SNX27 n/a
8 TRCN0000005723 CCTATCAATTACAGAAGCTAT pLKO.1 944 CDS 100% 4.950 3.465 N SNX27 n/a
9 TRCN0000005722 GCCCATTTAGTTTCATCCTTT pLKO.1 5112 3UTR 100% 4.950 3.465 N SNX27 n/a
10 TRCN0000072628 CCTCCCAAAGTGCTAGGATTA pLKO.1 3861 3UTR 100% 10.800 5.400 Y MRPS16 n/a
11 TRCN0000253473 AGCTGGAGAACCAGGTAATAG pLKO_005 1130 CDS 100% 13.200 9.240 N Snx27 n/a
12 TRCN0000140657 CCTCCCAAAGTGCTAGGATAA pLKO.1 3861 3UTR 100% 10.800 5.400 Y CD3EAP n/a
13 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2639 3UTR 100% 5.625 2.813 Y KLHL30 n/a
14 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2639 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005245510.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12725 pDONR223 100% 49.8% 49.5% None (many diffs) n/a
2 ccsbBroad304_12725 pLX_304 0% 49.8% 49.5% V5 (many diffs) n/a
3 TRCN0000478297 CCAGACCGGAACGTTATTTTCAGG pLX_317 46.2% 49.8% 49.5% V5 (many diffs) n/a
Download CSV