Construct: ORF TRCN0000478297
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007532.1_s317c1
- Derived from:
- ccsbBroadEn_12725
- DNA Barcode:
- CCAGACCGGAACGTTATTTTCAGG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SNX27 (81609)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478297
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 81609 | SNX27 | sorting nexin 27 | XM_005245511.4 | 64% | 64% | 1_369del |
| 2 | human | 81609 | SNX27 | sorting nexin 27 | XM_024450039.1 | 64% | 64% | 1_369del |
| 3 | human | 81609 | SNX27 | sorting nexin 27 | XM_024450038.1 | 61.4% | 61.1% | (many diffs) |
| 4 | human | 81609 | SNX27 | sorting nexin 27 | XM_017002417.1 | 53.8% | 53.8% | 1_564del |
| 5 | human | 81609 | SNX27 | sorting nexin 27 | XM_011510025.2 | 51.9% | 51.6% | (many diffs) |
| 6 | human | 81609 | SNX27 | sorting nexin 27 | XM_005245510.3 | 49.8% | 49.5% | (many diffs) |
| 7 | human | 81609 | SNX27 | sorting nexin 27 | XM_011510024.2 | 49.5% | 49.3% | (many diffs) |
| 8 | human | 81609 | SNX27 | sorting nexin 27 | NM_030918.6 | 41.4% | 41.4% | 1_927del |
| 9 | human | 81609 | SNX27 | sorting nexin 27 | NM_001330723.2 | 40.3% | 40.1% | (many diffs) |
| 10 | human | 81609 | SNX27 | sorting nexin 27 | XM_011510026.2 | 17.8% | 15.7% | (many diffs) |
| 11 | mouse | 76742 | Snx27 | sorting nexin family member 27 | XM_006502258.3 | 56.8% | 60% | (many diffs) |
| 12 | mouse | 76742 | Snx27 | sorting nexin family member 27 | NM_029721.2 | 38.4% | 40.8% | (many diffs) |
| 13 | mouse | 76742 | Snx27 | sorting nexin family member 27 | NM_001082484.2 | 37.4% | 39.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 723
- ORF length:
- 657
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga cagtacgaca gtgaattact ttgccttatt tgaagtgatc agtcactcct 121 ttgtacgtaa attggcacct aatgagtttc ctcacaaact ctacattcag aattatacat 181 cagctgtgcc aggcacctgc ttgaccattc gaaagtggct ttttacaaca gaagaagaaa 241 ttctcttaaa tgacaatgac cttgctgtta cctacttctt tcatcaggca gtcgatgatg 301 tgaagaaagg ttacatcaaa gcagaagaaa agtcctatca attacagaag ctatacgaac 361 aaagaaaaat ggtcatgtac ctcaacatgc taaggacttg tgagggctac aatgaaatca 421 TCTTTCCCCA CTGTGCCTGT GACTCCAGGA GGAAGGGGCA CGTTATCACA GCCATCAGCA 481 TCACGCACTT TAAACTGCAT GCCTGCACTG AAGAAGGACA GCTGGAGAAC CAGGTAATTG 541 CATTTGAATG GGATGAGATG CAGCGATGGG ACACAGATGA AGAAGGGATG GCCTTCTGTT 601 TCGAATATGC ACGAGGAGAG AAGAAGCCCC GATGGGTTAA AATCTTCACG CCATATTTCA 661 ATTACATGCA TGAGTGCTTC GAGAGGGTGT TCTGCGAGCT CAAGTGGAGA AAAGAGGAAT 721 ATTACCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 781 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 841 GGCTTTATAT ATCTTGTGGA AAGGACGACC AGACCGGAAC GTTATTTTCA GGACGCGTTA 901 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt