Transcript: Human XM_005245697.4

PREDICTED: Homo sapiens nuclear receptor subfamily 1 group I member 3 (NR1I3), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NR1I3 (9970)
Length:
1279
CDS:
87..1148

Additional Resources:

NCBI RefSeq record:
XM_005245697.4
NBCI Gene record:
NR1I3 (9970)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005245697.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021634 GCCACAGGCTACCACTTTAAT pLKO.1 138 CDS 100% 15.000 21.000 N NR1I3 n/a
2 TRCN0000236503 CAAGTCATCAAGTTTACTAAG pLKO_005 597 CDS 100% 10.800 15.120 N NR1I3 n/a
3 TRCN0000236502 GGGCCTCTTCGCTACACAATT pLKO_005 744 CDS 100% 13.200 10.560 N NR1I3 n/a
4 TRCN0000236505 GCATGAGGAAAGACATGATAC pLKO_005 310 CDS 100% 10.800 8.640 N NR1I3 n/a
5 TRCN0000021638 GAGTTGCTCTTTCACTTCCAT pLKO.1 804 CDS 100% 3.000 2.400 N NR1I3 n/a
6 TRCN0000236504 TTCGCAGACATCAACACTTTC pLKO_005 567 CDS 100% 10.800 7.560 N NR1I3 n/a
7 TRCN0000021635 GCAAGTCATCAAGTTTACTAA pLKO.1 596 CDS 100% 5.625 3.938 N NR1I3 n/a
8 TRCN0000021637 GACTCTGCAAAGCTACATCAA pLKO.1 971 CDS 100% 4.950 3.465 N NR1I3 n/a
9 TRCN0000236506 TCTGTCACATCGTACTCAATA pLKO_005 688 CDS 100% 13.200 7.920 N NR1I3 n/a
10 TRCN0000021636 CAACTGAGTAAGGAGCAAGAA pLKO.1 399 CDS 100% 4.950 2.970 N NR1I3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005245697.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07521 pDONR223 100% 97.3% 97.4% None 540C>T;693_694insGTATCTCCCACA;811_825del n/a
2 ccsbBroad304_07521 pLX_304 0% 97.3% 97.4% V5 540C>T;693_694insGTATCTCCCACA;811_825del n/a
3 TRCN0000476110 ACGTCTTCCAATCCCTCTGCTCTA pLX_317 37.6% 97.3% 97.4% V5 540C>T;693_694insGTATCTCCCACA;811_825del n/a
4 TRCN0000487830 GAGCGCTGTAGCAAACCAACACTC pLX_317 31.5% 97.2% 97.2% V5 (many diffs) n/a
5 TRCN0000487860 GGAGTTCCGCCTCCTAGATCTGGT pLX_317 32% 96.6% 97.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV