Transcript: Human XM_005247690.3

PREDICTED: Homo sapiens SUMO specific peptidase 2 (SENP2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SENP2 (59343)
Length:
3014
CDS:
120..1757

Additional Resources:

NCBI RefSeq record:
XM_005247690.3
NBCI Gene record:
SENP2 (59343)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005247690.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000004577 CGTCGCCATAGCAAAGGTAAT pLKO.1 612 CDS 100% 10.800 15.120 N SENP2 n/a
2 TRCN0000004575 CTGGGTAATAAATCTCCTAAT pLKO.1 474 CDS 100% 10.800 15.120 N SENP2 n/a
3 TRCN0000004578 GCAAAGGTAATCCAGAGAGTT pLKO.1 622 CDS 100% 4.950 6.930 N SENP2 n/a
4 TRCN0000355817 CATGCTGAAACTGGGTAATAA pLKO_005 464 CDS 100% 15.000 10.500 N SENP2 n/a
5 TRCN0000355816 ACAATGCTGCCAGCTTATTTG pLKO_005 310 CDS 100% 13.200 9.240 N SENP2 n/a
6 TRCN0000355815 ATAATGGGCAGTGGTCATTTA pLKO_005 2131 3UTR 100% 13.200 9.240 N SENP2 n/a
7 TRCN0000031027 CTAGGGACAAACCTATCACAT pLKO.1 1666 CDS 100% 4.950 3.465 N Senp2 n/a
8 TRCN0000318346 CTAGGGACAAACCTATCACAT pLKO_005 1666 CDS 100% 4.950 3.465 N Senp2 n/a
9 TRCN0000004576 GCAGTGAAACGATGGACCAAA pLKO.1 1344 CDS 100% 4.950 3.465 N SENP2 n/a
10 TRCN0000004579 CCACACAAGAACAAACGCTAA pLKO.1 1990 3UTR 100% 4.050 2.835 N SENP2 n/a
11 TRCN0000295305 CCTCATGCATTGTGGGTTAAA pLKO_005 1816 3UTR 100% 13.200 7.920 N Senp2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005247690.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03878 pDONR223 100% 92.5% 92.5% None 1110_1111ins132 n/a
2 ccsbBroad304_03878 pLX_304 0% 92.5% 92.5% V5 1110_1111ins132 n/a
3 TRCN0000471366 AAACCAAACCGTCATTTATCGTAT pLX_317 28.3% 92.5% 92.5% V5 1110_1111ins132 n/a
Download CSV