Transcript: Human XM_005247706.3

PREDICTED: Homo sapiens zinc finger matrin-type 3 (ZMAT3), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZMAT3 (64393)
Length:
8992
CDS:
332..1198

Additional Resources:

NCBI RefSeq record:
XM_005247706.3
NBCI Gene record:
ZMAT3 (64393)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005247706.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421327 ACGGAGAATGATTACTGTAAG pLKO_005 761 CDS 100% 10.800 15.120 N ZMAT3 n/a
2 TRCN0000446415 ATGGTGTTGAGCCGCTCATAG pLKO_005 1426 3UTR 100% 10.800 15.120 N ZMAT3 n/a
3 TRCN0000130357 GAAGAAGAGTTATCGAAGGGA pLKO.1 479 CDS 100% 0.750 0.600 N ZMAT3 n/a
4 TRCN0000437460 AGCAAGCCCAGGCTCATTATC pLKO_005 579 CDS 100% 13.200 9.240 N ZMAT3 n/a
5 TRCN0000130256 CCCATCATTGAAGCGCAAATT pLKO.1 1941 3UTR 100% 13.200 9.240 N ZMAT3 n/a
6 TRCN0000441835 TCCGCAGATGGGCTCCTTTAA pLKO_005 715 CDS 100% 13.200 9.240 N ZMAT3 n/a
7 TRCN0000128165 CATGGTAAGAAACTCCGAAAT pLKO.1 611 CDS 100% 10.800 7.560 N ZMAT3 n/a
8 TRCN0000424598 GAAGCTCAGAGTAACTCATTC pLKO_005 866 CDS 100% 10.800 7.560 N ZMAT3 n/a
9 TRCN0000129744 CATTTAGAGAGCAAGCAACAT pLKO.1 1118 CDS 100% 4.950 3.465 N ZMAT3 n/a
10 TRCN0000129131 GCTTGTCTAACAAGCCCATTT pLKO.1 2090 3UTR 100% 1.080 0.756 N ZMAT3 n/a
11 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 2215 3UTR 100% 4.950 2.475 Y ERAP2 n/a
12 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2216 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005247706.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03942 pDONR223 100% 99.6% 99.6% None 655_656insCAG n/a
2 ccsbBroad304_03942 pLX_304 0% 99.6% 99.6% V5 655_656insCAG n/a
3 TRCN0000475463 TGTCTTAAGCGGCGACGAGGACAT pLX_317 17.2% 99.6% 99.6% V5 655_656insCAG n/a
Download CSV