Transcript: Human XM_005247713.2

PREDICTED: Homo sapiens coiled-coil domain containing 14 (CCDC14), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CCDC14 (64770)
Length:
3786
CDS:
466..2727

Additional Resources:

NCBI RefSeq record:
XM_005247713.2
NBCI Gene record:
CCDC14 (64770)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005247713.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431737 AGAGCCACTTTCTACAATTAA pLKO_005 1983 CDS 100% 15.000 21.000 N CCDC14 n/a
2 TRCN0000136195 GAGGAACAAACTGCATGTCAT pLKO.1 2488 CDS 100% 4.950 6.930 N CCDC14 n/a
3 TRCN0000134762 GCAACCATTAAGAAGTGAGAA pLKO.1 1317 CDS 100% 4.950 6.930 N CCDC14 n/a
4 TRCN0000436053 AGAATGTATTCACCCATAATA pLKO_005 463 5UTR 100% 15.000 10.500 N CCDC14 n/a
5 TRCN0000429317 AGATGTATCTGCTGGATTAAG pLKO_005 3008 3UTR 100% 13.200 9.240 N CCDC14 n/a
6 TRCN0000426282 GACTCGACTAAGAGAATTAAC pLKO_005 1764 CDS 100% 13.200 9.240 N CCDC14 n/a
7 TRCN0000135638 GCCAGTGTTGTTGGTGAAATA pLKO.1 3189 3UTR 100% 13.200 9.240 N CCDC14 n/a
8 TRCN0000431013 TCAATTGGAGGAGTCACTAAA pLKO_005 1473 CDS 100% 13.200 9.240 N CCDC14 n/a
9 TRCN0000135912 GAAACCATAGAGCCAGACAAA pLKO.1 2011 CDS 100% 4.950 3.465 N CCDC14 n/a
10 TRCN0000138656 CCCATCAGGTTGTCTTAGCAA pLKO.1 2511 CDS 100% 3.000 2.100 N CCDC14 n/a
11 TRCN0000138592 CCTTCATGTAAGCAGCACGTT pLKO.1 3645 3UTR 100% 2.640 1.848 N CCDC14 n/a
12 TRCN0000136515 GCTAGACTCCAGAAGTCTTTA pLKO.1 2683 CDS 100% 1.320 0.924 N CCDC14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005247713.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12487 pDONR223 100% 99.8% 99.8% None 493A>C;1107T>C;1842C>T n/a
2 ccsbBroad304_12487 pLX_304 0% 99.8% 99.8% V5 493A>C;1107T>C;1842C>T n/a
3 TRCN0000471629 TGTATTAAACACTTCTTTCGCGGC pLX_317 17.8% 99.8% 99.8% V5 493A>C;1107T>C;1842C>T n/a
Download CSV