Transcript: Human XM_005247739.2

PREDICTED: Homo sapiens transient receptor potential cation channel subfamily C member 1 (TRPC1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TRPC1 (7220)
Length:
3797
CDS:
159..2144

Additional Resources:

NCBI RefSeq record:
XM_005247739.2
NBCI Gene record:
TRPC1 (7220)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005247739.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000070033 CCGAAATGAAATAAGGGATTT pLKO.1 2075 CDS 100% 10.800 15.120 N Trpc1 n/a
2 TRCN0000044000 GCTCATCGTAACAACTATGAA pLKO.1 261 CDS 100% 5.625 7.875 N TRPC1 n/a
3 TRCN0000291283 GCTCATCGTAACAACTATGAA pLKO_005 261 CDS 100% 5.625 7.875 N TRPC1 n/a
4 TRCN0000044001 GCATCGTTACTTGACTTCCAT pLKO.1 1979 CDS 100% 3.000 4.200 N TRPC1 n/a
5 TRCN0000296818 CTAAATCATGGAGCGAATAAT pLKO_005 2152 3UTR 100% 15.000 12.000 N TRPC1 n/a
6 TRCN0000043998 GCCCACCTGTAAGAAGATAAT pLKO.1 797 CDS 100% 13.200 9.240 N TRPC1 n/a
7 TRCN0000291284 GCCCACCTGTAAGAAGATAAT pLKO_005 797 CDS 100% 13.200 9.240 N TRPC1 n/a
8 TRCN0000043999 GCTACTTTGATGACAAATGTA pLKO.1 1771 CDS 100% 5.625 3.938 N TRPC1 n/a
9 TRCN0000044002 GCTAAGGATTTACTTGCACAA pLKO.1 567 CDS 100% 4.050 2.835 N TRPC1 n/a
10 TRCN0000291227 GCTAAGGATTTACTTGCACAA pLKO_005 567 CDS 100% 4.050 2.835 N TRPC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005247739.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01713 pDONR223 100% 87% 85.3% None 0_1ins139;32_33ins155 n/a
2 ccsbBroad304_01713 pLX_304 0% 87% 85.3% V5 0_1ins139;32_33ins155 n/a
3 TRCN0000468696 TTCATTGTTAAATCCATGTTCTCC pLX_317 18.6% 87% 85.3% V5 0_1ins139;32_33ins155 n/a
Download CSV