Transcript: Human XM_005247793.3

PREDICTED: Homo sapiens polyhomeotic homolog 3 (PHC3), transcript variant X19, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PHC3 (80012)
Length:
1890
CDS:
31..1875

Additional Resources:

NCBI RefSeq record:
XM_005247793.3
NBCI Gene record:
PHC3 (80012)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005247793.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415999 CGACATGCTGTACAGGTAATT pLKO_005 196 CDS 100% 13.200 18.480 N PHC3 n/a
2 TRCN0000143157 CAAGTCAGTCTCCTACTATAA pLKO.1 1283 CDS 100% 13.200 9.240 N PHC3 n/a
3 TRCN0000139438 CCAGTGGAAGACCATCTACAT pLKO.1 377 CDS 100% 4.950 3.465 N PHC3 n/a
4 TRCN0000139200 CCTTGCAGTCTATGCAGTCTT pLKO.1 1616 CDS 100% 4.950 3.465 N PHC3 n/a
5 TRCN0000142291 GCAGTATTACCCAACAGACTA pLKO.1 515 CDS 100% 4.950 3.465 N PHC3 n/a
6 TRCN0000140669 CAACAGCACTTGATGCTGCAT pLKO.1 283 CDS 100% 0.264 0.185 N PHC3 n/a
7 TRCN0000441135 CACAGACTGTTGCGGTAAATC pLKO_005 1760 CDS 100% 13.200 9.240 N Phc3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005247793.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15997 pDONR223 0% 20.9% 19.7% None (many diffs) n/a
2 ccsbBroad304_15997 pLX_304 0% 20.9% 19.7% V5 (many diffs) n/a
3 TRCN0000473121 TTTTTCCGCTAGGGCAAAAGAACA pLX_317 96% 20.9% 19.7% V5 (many diffs) n/a
Download CSV