Transcript: Human XM_005248119.4

PREDICTED: Homo sapiens ATPase phospholipid transporting 10D (putative) (ATP10D), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ATP10D (57205)
Length:
6031
CDS:
296..4531

Additional Resources:

NCBI RefSeq record:
XM_005248119.4
NBCI Gene record:
ATP10D (57205)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005248119.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419801 GTCAGGCTCCAGTCGGAATTT pLKO_005 4899 3UTR 100% 13.200 9.240 N ATP10D n/a
2 TRCN0000051540 GCCTATGTGAACAATCGAATA pLKO.1 503 CDS 100% 10.800 7.560 N ATP10D n/a
3 TRCN0000051541 GCCCTTTGACTCAGTAAGAAA pLKO.1 2560 CDS 100% 5.625 3.938 N ATP10D n/a
4 TRCN0000051538 CGGCTCTTTATGCCACTAGAT pLKO.1 1943 CDS 100% 4.950 3.465 N ATP10D n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005248119.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12336 pDONR223 100% 37.6% 37.5% None 1592A>T;1594_1595insGTATGAATG;1597_4233del n/a
2 ccsbBroad304_12336 pLX_304 0% 37.6% 37.5% V5 1592A>T;1594_1595insGTATGAATG;1597_4233del n/a
3 TRCN0000468955 TCAGCGCCGAGCTATCAGGTTTAT pLX_317 23.8% 37.6% 37.5% V5 1592A>T;1594_1595insGTATGAATG;1597_4233del n/a
Download CSV