Transcript: Human XM_005248446.4

PREDICTED: Homo sapiens MARVEL domain containing 2 (MARVELD2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MARVELD2 (153562)
Length:
4207
CDS:
163..1839

Additional Resources:

NCBI RefSeq record:
XM_005248446.4
NBCI Gene record:
MARVELD2 (153562)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005248446.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000072633 GCAGCATCTATCATGTAGATA pLKO.1 3820 3UTR 100% 0.563 0.450 N MARVELD2 n/a
2 TRCN0000072637 CCTGAGATACTCCTACATGAA pLKO.1 702 CDS 100% 4.950 3.465 N MARVELD2 n/a
3 TRCN0000072636 CGCAGCCATAGTCTATGTGAA pLKO.1 1080 CDS 100% 4.950 3.465 N MARVELD2 n/a
4 TRCN0000072635 GCAGCCATAGTCTATGTGAAT pLKO.1 1081 CDS 100% 4.950 3.465 N MARVELD2 n/a
5 TRCN0000072634 GCTGCAATGATCTTCCTGTTT pLKO.1 1189 CDS 100% 4.950 3.465 N MARVELD2 n/a
6 TRCN0000008902 CCTCCCAAAGTGTTGGGATTA pLKO.1 3268 3UTR 100% 1.080 0.540 Y GPR83 n/a
7 TRCN0000156315 CCTCCCAAAGTGTTGGGATTA pLKO.1 3268 3UTR 100% 1.080 0.540 Y MYORG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005248446.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09697 pDONR223 100% 99.9% 99.8% None 98C>T n/a
2 ccsbBroad304_09697 pLX_304 0% 99.9% 99.8% V5 98C>T n/a
3 TRCN0000477522 TGAATCCGATGGTTCACACTTACC pLX_317 24.4% 99.9% 99.8% V5 98C>T n/a
Download CSV