Transcript: Human XM_005248551.4

PREDICTED: Homo sapiens WD repeat domain 41 (WDR41), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
WDR41 (55255)
Length:
4108
CDS:
288..1493

Additional Resources:

NCBI RefSeq record:
XM_005248551.4
NBCI Gene record:
WDR41 (55255)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005248551.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000147209 CCGCTGATCATCTCATTATTT pLKO.1 1381 CDS 100% 15.000 21.000 N WDR41 n/a
2 TRCN0000369220 ATACGTGTATAGCCTTCAAAT pLKO_005 1025 CDS 100% 13.200 18.480 N WDR41 n/a
3 TRCN0000376411 GAATCTGGATTGCGCAGTTTA pLKO_005 1422 CDS 100% 13.200 18.480 N WDR41 n/a
4 TRCN0000148509 CCTAGATCCTTGTGAAAGGTA pLKO.1 1766 3UTR 100% 3.000 4.200 N WDR41 n/a
5 TRCN0000364521 TATACCTTGCTGTCTAGTTTA pLKO_005 1477 CDS 100% 13.200 10.560 N WDR41 n/a
6 TRCN0000364522 CATGTTCACTGGAGCTTATTG pLKO_005 1288 CDS 100% 13.200 9.240 N WDR41 n/a
7 TRCN0000369218 TGCTTCTCAGGTCCTAGTATA pLKO_005 1658 3UTR 100% 13.200 9.240 N WDR41 n/a
8 TRCN0000183411 CCAAAGAATATACCACAAGTT pLKO.1 1683 3UTR 100% 4.950 3.465 N WDR41 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005248551.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03564 pDONR223 100% 87.3% 87.3% None 522_523ins174 n/a
2 ccsbBroad304_03564 pLX_304 0% 87.3% 87.3% V5 522_523ins174 n/a
3 TRCN0000491687 AATACCTCGCAAGCCACCGTGAGT pLX_317 25.6% 87.3% 87.3% V5 522_523ins174 n/a
4 ccsbBroadEn_15893 pDONR223 0% 60.4% 60.3% None (many diffs) n/a
5 ccsbBroad304_15893 pLX_304 0% 60.4% 60.3% V5 (many diffs) n/a
Download CSV