Transcript: Human XM_005248606.5

PREDICTED: Homo sapiens ELOVL fatty acid elongase 7 (ELOVL7), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ELOVL7 (79993)
Length:
1893
CDS:
765..1610

Additional Resources:

NCBI RefSeq record:
XM_005248606.5
NBCI Gene record:
ELOVL7 (79993)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005248606.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116229 CCAGTTTGTTATTGTCGCCAT pLKO.1 1403 CDS 100% 2.160 3.024 N ELOVL7 n/a
2 TRCN0000175369 CGATGTGACATTGTTGACTAT pLKO.1 1056 CDS 100% 4.950 3.960 N Elovl7 n/a
3 TRCN0000116228 CCTGGTGGTTTGGAGTCAAAT pLKO.1 1234 CDS 100% 13.200 9.240 N ELOVL7 n/a
4 TRCN0000329119 ATGTGACATTGTTGACTATTC pLKO_005 1058 CDS 100% 10.800 7.560 N Elovl7 n/a
5 TRCN0000116230 GAACTCAAGAAAGCAATGATA pLKO.1 951 CDS 100% 5.625 3.938 N ELOVL7 n/a
6 TRCN0000116231 TGTCACTTCCTTGGGACCAAA pLKO.1 905 CDS 100% 4.950 3.465 N ELOVL7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005248606.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04160 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04160 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000492024 CTACGTCGAAAGAAACTCCTTGCG pLX_317 43.1% 100% 100% V5 n/a
4 ccsbBroadEn_04161 pDONR223 100% 100% 100% None n/a
5 ccsbBroad304_04161 pLX_304 0% 100% 100% V5 n/a
6 TRCN0000476190 GTTGCAGGTTGACCTGATTAAATA pLX_317 28.4% 100% 100% V5 n/a
Download CSV