Transcript: Human XM_005249310.4

PREDICTED: Homo sapiens dystonin (DST), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DST (667)
Length:
24464
CDS:
67..23523

Additional Resources:

NCBI RefSeq record:
XM_005249310.4
NBCI Gene record:
DST (667)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005249310.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000053531 GCACCTTGATACACTCCATAA pLKO.1 2787 CDS 100% 10.800 15.120 N DST n/a
2 TRCN0000300045 GCACCTTGATACACTCCATAA pLKO_005 2787 CDS 100% 10.800 15.120 N DST n/a
3 TRCN0000303930 ATACTACCAGGCAGATCAATT pLKO_005 2064 CDS 100% 13.200 9.240 N DST n/a
4 TRCN0000310784 TGGACCTAAGGACTCGATATA pLKO_005 4901 CDS 100% 13.200 9.240 N DST n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005249310.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10698 pDONR223 100% 14.1% 13.6% None (many diffs) n/a
2 ccsbBroad304_10698 pLX_304 0% 14.1% 13.6% V5 (many diffs) n/a
3 TRCN0000467550 GTATCGAGCTCTGCGTGTCACTGC pLX_317 9.9% 14.1% 13.6% V5 (many diffs) n/a
Download CSV