Transcript: Human XM_005250237.1

PREDICTED: Homo sapiens adenosylhomocysteinase like 2 (AHCYL2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AHCYL2 (23382)
Length:
5068
CDS:
373..1902

Additional Resources:

NCBI RefSeq record:
XM_005250237.1
NBCI Gene record:
AHCYL2 (23382)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005250237.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000050167 GCAGAGTTTGGACGAAGAGAA pLKO.1 646 CDS 100% 4.950 6.930 N AHCYL2 n/a
2 TRCN0000050165 CCGTATGAAGAATAGCTGCAT pLKO.1 1467 CDS 100% 2.640 3.696 N AHCYL2 n/a
3 TRCN0000050163 CCAAACATGATCTTGGATGAT pLKO.1 976 CDS 100% 4.950 3.465 N AHCYL2 n/a
4 TRCN0000050166 GCTCTAGCAGAAAGTGGATTT pLKO.1 874 CDS 100% 10.800 6.480 N AHCYL2 n/a
5 TRCN0000050164 GCCTTGATAGAGCTTTACAAT pLKO.1 1702 CDS 100% 5.625 3.375 N AHCYL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005250237.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02757 pDONR223 100% 81.7% 81% None (many diffs) n/a
2 ccsbBroad304_02757 pLX_304 0% 81.7% 81% V5 (many diffs) n/a
3 TRCN0000481020 AAAGACACGACGTGGTCGTCTCCA pLX_317 22% 81.7% 81% V5 (many diffs) n/a
Download CSV