Transcript: Human XM_005250686.5

PREDICTED: Homo sapiens plexin A4 (PLXNA4), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PLXNA4 (91584)
Length:
13324
CDS:
501..6185

Additional Resources:

NCBI RefSeq record:
XM_005250686.5
NBCI Gene record:
PLXNA4 (91584)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005250686.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000359758 GTTCGTGGCCTCGATGATTAA pLKO_005 1163 CDS 100% 13.200 18.480 N PLXNA4 n/a
2 TRCN0000078684 GCTCTTAACCATTGACGATAA pLKO.1 1688 CDS 100% 10.800 15.120 N PLXNA4 n/a
3 TRCN0000078685 GCAGCGGTCATTTGTCACATT pLKO.1 608 CDS 100% 4.950 6.930 N PLXNA4 n/a
4 TRCN0000078686 GCGCTCTTAACCATTGACGAT pLKO.1 1686 CDS 100% 2.640 3.696 N PLXNA4 n/a
5 TRCN0000078683 GCAGATAAATGACCGCATTAA pLKO.1 1583 CDS 100% 13.200 9.240 N PLXNA4 n/a
6 TRCN0000359686 TGGATGGGAAGCCCGAGTATT pLKO_005 1066 CDS 100% 13.200 9.240 N PLXNA4 n/a
7 TRCN0000359757 CTCTTAACCATTGACGATAAC pLKO_005 1689 CDS 100% 10.800 7.560 N PLXNA4 n/a
8 TRCN0000078687 CCTGACTTTGATATCTACTAT pLKO.1 1212 CDS 100% 5.625 3.938 N PLXNA4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005250686.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09318 pDONR223 100% 26.4% 24.7% None (many diffs) n/a
2 ccsbBroad304_09318 pLX_304 0% 26.4% 24.7% V5 (many diffs) n/a
3 TRCN0000471262 TTAATACTGAATGATTGGCCACGG pLX_317 25.5% 26.4% 24.7% V5 (many diffs) n/a
4 ccsbBroadEn_15213 pDONR223 0% 26.4% 24.7% None (many diffs) n/a
5 ccsbBroad304_15213 pLX_304 0% 26.4% 24.7% V5 (many diffs) n/a
6 TRCN0000479825 ATTTGACATTCATAACGAACGTTT pLX_317 22.5% 26.4% 24.7% V5 (many diffs) n/a
Download CSV