Transcript: Human XM_005250710.1

PREDICTED: Homo sapiens carboxypeptidase A5 (CPA5), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CPA5 (93979)
Length:
1992
CDS:
549..1859

Additional Resources:

NCBI RefSeq record:
XM_005250710.1
NBCI Gene record:
CPA5 (93979)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005250710.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047043 GCCAATAAGATTGTCAGTGAT pLKO.1 1176 CDS 100% 4.950 6.930 N CPA5 n/a
2 TRCN0000047046 CGGAAGAACAAGTCCATCAGA pLKO.1 1308 CDS 100% 3.000 4.200 N CPA5 n/a
3 TRCN0000371833 CCCACAGCATGAACCGCTTAT pLKO_005 1285 CDS 100% 10.800 7.560 N CPA5 n/a
4 TRCN0000047044 GCATTCCGATATTGTCTCAAA pLKO.1 1013 CDS 100% 4.950 3.465 N CPA5 n/a
5 TRCN0000047045 CGTTTCAAATCAGAGGGAGTT pLKO.1 1565 CDS 100% 4.050 2.835 N CPA5 n/a
6 TRCN0000047047 CTGTGGATATGAGAGTTCCTT pLKO.1 784 CDS 100% 3.000 2.100 N CPA5 n/a
7 TRCN0000371890 AGCTTCAGTTACTCATCATAC pLKO_005 945 CDS 100% 10.800 6.480 N CPA5 n/a
8 TRCN0000428751 CATCAGCACCACCCTCTATTC pLKO_005 1655 CDS 100% 10.800 7.560 N Cpa5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005250710.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09363 pDONR223 100% 99.6% 99.7% None (many diffs) n/a
2 ccsbBroad304_09363 pLX_304 0% 99.6% 99.7% V5 (many diffs) n/a
3 TRCN0000469314 TGTTTTCCGGTAATCCACTCCGCC pLX_317 32.3% 99.6% 99.7% V5 (many diffs) n/a
4 ccsbBroadEn_16071 pDONR223 0% 99.6% 99.5% None (many diffs) n/a
5 ccsbBroad304_16071 pLX_304 0% 99.6% 99.5% V5 (many diffs) n/a
6 TRCN0000467135 GCCGCTTACCTCTTTAAGGCTCTA pLX_317 32.3% 99.6% 99.5% V5 (many diffs) n/a
Download CSV