Transcript: Human XM_005250760.4

PREDICTED: Homo sapiens WW domain containing E3 ubiquitin protein ligase 1 (WWP1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
WWP1 (11059)
Length:
4300
CDS:
293..3061

Additional Resources:

NCBI RefSeq record:
XM_005250760.4
NBCI Gene record:
WWP1 (11059)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005250760.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000273544 GACTTGAGGAGGCGCTTATAT pLKO_005 2063 CDS 100% 15.000 21.000 N WWP1 n/a
2 TRCN0000003395 ATTGCTTATGAACGCGGCTTT pLKO.1 1913 CDS 100% 4.050 5.670 N WWP1 n/a
3 TRCN0000273488 ATTGCTTATGAACGCGGCTTT pLKO_005 1913 CDS 100% 4.050 5.670 N WWP1 n/a
4 TRCN0000010782 GCTTATTTGAGTATGCGGGCA pLKO.1 2178 CDS 100% 0.540 0.756 N WWP1 n/a
5 TRCN0000273487 CATGGAATCTGTCCGAAATTT pLKO_005 1531 CDS 100% 15.000 10.500 N WWP1 n/a
6 TRCN0000003398 CCTCTCAAATTCATAACAGTT pLKO.1 4067 3UTR 100% 4.950 3.465 N WWP1 n/a
7 TRCN0000003397 TCTGTAACTAAAGGTGGTCCA pLKO.1 1889 CDS 100% 2.160 1.512 N WWP1 n/a
8 TRCN0000273485 TCTGTAACTAAAGGTGGTCCA pLKO_005 1889 CDS 100% 2.160 1.512 N WWP1 n/a
9 TRCN0000003396 ACAACACACCTTCATCTCCGT pLKO.1 924 CDS 100% 0.660 0.462 N WWP1 n/a
10 TRCN0000273486 GCTGTTCAGAAAGGTATTAAG pLKO_005 3513 3UTR 100% 13.200 7.920 N WWP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005250760.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02607 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02607 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000479200 CCTTTGAACGACAGGCACATGCAG pLX_317 15.5% 100% 100% V5 n/a
Download CSV