Transcript: Human XM_005250856.3

PREDICTED: Homo sapiens regulator of G protein signaling 22 (RGS22), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RGS22 (26166)
Length:
4860
CDS:
1026..4661

Additional Resources:

NCBI RefSeq record:
XM_005250856.3
NBCI Gene record:
RGS22 (26166)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005250856.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423772 GTATGCAAGCAAGCGCAATAT pLKO_005 3174 CDS 100% 13.200 18.480 N RGS22 n/a
2 TRCN0000148118 GCAATGGAGATTACTACCTTT pLKO.1 2413 CDS 100% 4.950 3.960 N RGS22 n/a
3 TRCN0000219846 AGTCGTGAAGAAGGTATTAAG pLKO.1 1371 CDS 100% 13.200 9.240 N RGS22 n/a
4 TRCN0000427050 ATTGAGCAGTTCCGGAGAATA pLKO_005 3678 CDS 100% 13.200 9.240 N RGS22 n/a
5 TRCN0000413629 GATGGATATTGAGAGGTTAAA pLKO_005 2327 CDS 100% 13.200 9.240 N RGS22 n/a
6 TRCN0000147225 GAGTCTATTCATGGCAAGAAT pLKO.1 2097 CDS 100% 5.625 3.938 N RGS22 n/a
7 TRCN0000147377 GCAACAGATGATTTCCTTGTA pLKO.1 1092 CDS 100% 4.950 3.465 N RGS22 n/a
8 TRCN0000428326 GAACAGAATATTGGGATAATG pLKO_005 3535 CDS 100% 13.200 7.920 N RGS22 n/a
9 TRCN0000134370 GAAGAAGAAGAAGGAGAAGAA pLKO.1 1830 CDS 100% 4.950 2.475 Y TNFAIP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005250856.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07998 pDONR223 100% 95.7% 95.6% None (many diffs) n/a
2 ccsbBroad304_07998 pLX_304 0% 95.7% 95.6% V5 (many diffs) n/a
3 TRCN0000492324 AAATACGGAGCCGCTGTGTGCGCC pLX_317 12.2% 95.7% 95.6% V5 (many diffs) n/a
4 ccsbBroadEn_15783 pDONR223 0% 41.5% 41.5% None 391G>C;909A>G;1513_3633del n/a
5 ccsbBroad304_15783 pLX_304 0% 41.5% 41.5% V5 391G>C;909A>G;1513_3633del n/a
6 TRCN0000478762 ATAGTATCGTGCCTACATCAGGTA pLX_317 28.7% 41.5% 41.5% V5 391G>C;909A>G;1513_3633del n/a
Download CSV