Transcript: Human XM_005251087.3

PREDICTED: Homo sapiens family with sequence similarity 83 member A (FAM83A), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FAM83A (84985)
Length:
3811
CDS:
285..1421

Additional Resources:

NCBI RefSeq record:
XM_005251087.3
NBCI Gene record:
FAM83A (84985)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005251087.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000168628 GCAGGTTAGTAGACTCAGATT pLKO.1 2098 3UTR 100% 4.950 3.960 N FAM83A n/a
2 TRCN0000168368 GAGTGTGGAAGGAGAGATATA pLKO.1 779 CDS 100% 13.200 9.240 N FAM83A n/a
3 TRCN0000429328 AGGAAATTCGCTGGCCAAATC pLKO_005 816 CDS 100% 10.800 7.560 N FAM83A n/a
4 TRCN0000422630 AGATGGTAGTTTGGTACTTCT pLKO_005 1810 3UTR 100% 4.950 3.465 N FAM83A n/a
5 TRCN0000172664 GACTGGAGATTTGTCCTGTCT pLKO.1 858 CDS 100% 2.640 1.848 N FAM83A n/a
6 TRCN0000172916 GCACAACAACATCAGAGACCT pLKO.1 713 CDS 100% 2.640 1.848 N FAM83A n/a
7 TRCN0000166857 CCATCATTCATTTCTTCTCAA pLKO.1 2325 3UTR 100% 4.950 2.970 N FAM83A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005251087.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04461 pDONR223 100% 87% 87% None 478_479ins168 n/a
2 ccsbBroad304_04461 pLX_304 0% 87% 87% V5 478_479ins168 n/a
3 TRCN0000470333 GAGGACCCAGAGGCGATACGGGTG pLX_317 27.9% 87% 87% V5 478_479ins168 n/a
4 ccsbBroadEn_12899 pDONR223 100% 77.5% 76.7% None (many diffs) n/a
5 ccsbBroad304_12899 pLX_304 0% 77.5% 76.7% V5 (many diffs) n/a
6 TRCN0000473713 GCAAAGACACGTAGACGATAAGCC pLX_317 49.3% 77.5% 76.7% V5 (many diffs) n/a
Download CSV