Transcript: Human XM_005251168.3

PREDICTED: Homo sapiens peroxidasin like (PXDNL), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PXDNL (137902)
Length:
2956
CDS:
94..2640

Additional Resources:

NCBI RefSeq record:
XM_005251168.3
NBCI Gene record:
PXDNL (137902)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005251168.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064695 CCTATTCTTTACCGACTGAAT pLKO.1 1432 CDS 100% 4.950 6.930 N PXDNL n/a
2 TRCN0000064697 GCTCAATACAGCTATCCTGTT pLKO.1 2209 CDS 100% 4.050 5.670 N PXDNL n/a
3 TRCN0000433338 ACGTGAATGCAGGCATCATTA pLKO_005 1364 CDS 100% 13.200 9.240 N PXDNL n/a
4 TRCN0000064696 CCACACATTAATCAATCCTAT pLKO.1 1416 CDS 100% 4.950 3.465 N PXDNL n/a
5 TRCN0000064694 CCCAGTCCTGAATTGGTGAAA pLKO.1 2557 CDS 100% 4.950 3.465 N PXDNL n/a
6 TRCN0000064693 CCGTCCAGAATAATCAAGGAA pLKO.1 1510 CDS 100% 3.000 2.100 N PXDNL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005251168.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13195 pDONR223 100% 60.6% 58.6% None (many diffs) n/a
2 ccsbBroad304_13195 pLX_304 0% 60.6% 58.6% V5 (many diffs) n/a
3 TRCN0000480265 TGTTAGGAAAGAACTCTAAATTTG pLX_317 28.5% 60.6% 58.6% V5 (many diffs) n/a
Download CSV