Transcript: Human XM_005251675.2

PREDICTED: Homo sapiens solute carrier family 35 member D2 (SLC35D2), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC35D2 (11046)
Length:
1470
CDS:
62..934

Additional Resources:

NCBI RefSeq record:
XM_005251675.2
NBCI Gene record:
SLC35D2 (11046)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005251675.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044452 CGTTGCCTACATTGGGATATT pLKO.1 760 CDS 100% 13.200 18.480 N SLC35D2 n/a
2 TRCN0000044448 GCCACCATAATGATACTATAT pLKO.1 260 CDS 100% 13.200 10.560 N SLC35D2 n/a
3 TRCN0000415219 ACGGTTCTGTGCAGCTATTAC pLKO_005 692 CDS 100% 13.200 9.240 N SLC35D2 n/a
4 TRCN0000427761 GGATTATCAAGCACAAGTAAA pLKO_005 383 CDS 100% 13.200 9.240 N SLC35D2 n/a
5 TRCN0000044451 CCAATGGAAGAATGTTGTGTT pLKO.1 619 CDS 100% 4.950 3.465 N SLC35D2 n/a
6 TRCN0000044449 GCCATCAAGAATGTATCCGTT pLKO.1 743 CDS 100% 2.640 1.848 N SLC35D2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005251675.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02606 pDONR223 100% 86% 85.7% None 346_347ins141 n/a
2 ccsbBroad304_02606 pLX_304 0% 86% 85.7% V5 346_347ins141 n/a
3 TRCN0000476320 GTTAGAAGACCTGCGACGCTAGGT pLX_317 38.2% 86% 85.7% V5 346_347ins141 n/a
Download CSV