Transcript: Human XM_005252086.1

PREDICTED: Homo sapiens hemogen (HEMGN), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HEMGN (55363)
Length:
2213
CDS:
166..1620

Additional Resources:

NCBI RefSeq record:
XM_005252086.1
NBCI Gene record:
HEMGN (55363)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005252086.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430486 TAACAATGCTCAACCATAAAG pLKO_005 1618 CDS 100% 13.200 18.480 N HEMGN n/a
2 TRCN0000426467 TTACGTCTTAAGAGCAGATAA pLKO_005 1933 3UTR 100% 13.200 18.480 N HEMGN n/a
3 TRCN0000413321 AGAATCAGCTGAACCTAAATA pLKO_005 1113 CDS 100% 15.000 10.500 N HEMGN n/a
4 TRCN0000128344 GATGTGCCTAAAGGCTATATT pLKO.1 958 CDS 100% 15.000 10.500 N HEMGN n/a
5 TRCN0000413439 ATGTACCAAGATATGGCTAAA pLKO_005 817 CDS 100% 10.800 7.560 N HEMGN n/a
6 TRCN0000128662 CCAATGGAACATACAGCTTAA pLKO.1 1646 3UTR 100% 10.800 7.560 N HEMGN n/a
7 TRCN0000129994 GCAATTCTGAATGAGAGTCAT pLKO.1 1564 CDS 100% 4.950 3.465 N HEMGN n/a
8 TRCN0000128051 GAAGAGAACCATTCTCCAGAA pLKO.1 226 CDS 100% 4.050 2.835 N HEMGN n/a
9 TRCN0000129449 GATCCTAAAGCACACCAGGAA pLKO.1 1474 CDS 100% 2.640 1.848 N HEMGN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005252086.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12213 pDONR223 100% 99.7% 99.5% None 287_289delTAG n/a
2 ccsbBroad304_12213 pLX_304 0% 99.7% 99.5% V5 287_289delTAG n/a
3 TRCN0000476755 CAGATATTACTAAGCATGACTTCA pLX_317 20.3% 99.7% 99.5% V5 287_289delTAG n/a
Download CSV