Transcript: Human XM_005252830.4

PREDICTED: Homo sapiens switching B cell complex subunit SWAP70 (SWAP70), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SWAP70 (23075)
Length:
4746
CDS:
452..1762

Additional Resources:

NCBI RefSeq record:
XM_005252830.4
NBCI Gene record:
SWAP70 (23075)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005252830.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296968 CCTAAGGAAGCCTTCTTATTT pLKO_005 2223 3UTR 100% 15.000 10.500 N SWAP70 n/a
2 TRCN0000055574 GCCCATCATGAAGGATTAATT pLKO.1 1619 CDS 100% 15.000 10.500 N SWAP70 n/a
3 TRCN0000296909 GCTGGAGATGGCAACTAATAA pLKO_005 1573 CDS 100% 15.000 10.500 N SWAP70 n/a
4 TRCN0000055575 GCCTGACAAAGATGGAAAGAA pLKO.1 799 CDS 100% 5.625 3.938 N SWAP70 n/a
5 TRCN0000291334 GCCTGACAAAGATGGAAAGAA pLKO_005 799 CDS 100% 5.625 3.938 N SWAP70 n/a
6 TRCN0000055576 GCCTTTCTGCATGGGAACTTA pLKO.1 519 CDS 100% 5.625 3.938 N SWAP70 n/a
7 TRCN0000055577 GCTTTCACTGAGGCAGAACTT pLKO.1 1697 CDS 100% 4.950 3.465 N SWAP70 n/a
8 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 1867 3UTR 100% 4.950 2.475 Y ERAP2 n/a
9 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1868 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005252830.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02719 pDONR223 100% 74.5% 74.5% None 0_1ins447 n/a
2 ccsbBroad304_02719 pLX_304 0% 74.5% 74.5% V5 0_1ins447 n/a
3 TRCN0000466687 CAACGATCGAGTTGTAACGAAGGG pLX_317 17.2% 74.5% 74.5% V5 0_1ins447 n/a
Download CSV