Transcript: Human XM_005253170.3

PREDICTED: Homo sapiens 1-aminocyclopropane-1-carboxylate synthase homolog (inactive) (ACCS), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ACCS (84680)
Length:
2534
CDS:
281..2089

Additional Resources:

NCBI RefSeq record:
XM_005253170.3
NBCI Gene record:
ACCS (84680)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005253170.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045572 GTCTACATGCTGTCCGTGTTT pLKO.1 1445 CDS 100% 4.950 6.930 N ACCS n/a
2 TRCN0000045570 CTACAGGAGTACCTGGTATTT pLKO.1 1388 CDS 100% 13.200 9.240 N ACCS n/a
3 TRCN0000421391 AGAATGTGGTTGTCCTGAATG pLKO_005 1068 CDS 100% 10.800 7.560 N ACCS n/a
4 TRCN0000417996 AGCAGGTGCTTGCAGGCAAAT pLKO_005 2007 CDS 100% 10.800 7.560 N ACCS n/a
5 TRCN0000434149 CCTACCACATGGATGAGTATG pLKO_005 831 CDS 100% 10.800 7.560 N ACCS n/a
6 TRCN0000433414 GCAAGGCCTTCGAGTGTAAAG pLKO_005 1917 CDS 100% 10.800 7.560 N ACCS n/a
7 TRCN0000045569 CCTGTCCTCTAGAGGAAGAAT pLKO.1 769 CDS 100% 5.625 3.938 N ACCS n/a
8 TRCN0000045571 CTGGGTTGACTTGAGAAAGTA pLKO.1 1819 CDS 100% 5.625 3.938 N ACCS n/a
9 TRCN0000045568 CGTGTGTCTCTATGGCAACAT pLKO.1 1186 CDS 100% 4.950 3.465 N ACCS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005253170.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09216 pDONR223 100% 83.1% 83% None 1_303del;1174C>T;1565C>T n/a
2 ccsbBroad304_09216 pLX_304 0% 83.1% 83% V5 1_303del;1174C>T;1565C>T n/a
3 TRCN0000471768 AAGGAAGATTATGATCTACCGAAT pLX_317 30.7% 83.1% 83% V5 1_303del;1174C>T;1565C>T n/a
Download CSV